Cumulus WDL workflows and Dockerfiles

Release License Docs

All of our docker images are publicly available on Quay and Docker Hub. Our workflows use Quay as the default Docker registry. Users can use Docker Hub as the Docker registry by entering cumulusprod for the workflow input “docker_registry”, or enter a custom registry name of their own choice.

If you use Cumulus in your research, please consider citing:

Li, B., Gould, J., Yang, Y. et al. “Cumulus provides cloud-based data analysis for large-scale single-cell and single-nucleus RNA-seq”. Nat Methods 17, 793–798 (2020). https://doi.org/10.1038/s41592-020-0905-x

Version 1.2.0 January 19, 2021

  • Add spaceranger workflow:
    • Wrap up spaceranger version 1.2.1
  • On cellranger workflow:
    • Fix workflow WDL to support both single index and dual index
    • Add support for cellranger version 5.0.0 and 5.0.1
    • Add support for targeted gene expression analysis
    • Add support for --include-introns and --no-bam options for cellranger count
    • Remove --force-cells option for cellranger vdj as noted in cellranger 5.0.0 release note
    • Add GRCh38_vdj_v5.0.0 and GRCm38_vdj_v5.0.0 references
  • Bug fix on cumulus workflow.
  • Reorganize the sidebar of Cumulus documentation website.

Version 1.1.0 December 28, 2020

  • On cumulus workflow:
    • Add CITE-Seq data analysis back. (See section Run CITE-Seq analysis for details)
    • Add doublet detection. (See infer_doublets, expected_doublet_rate, and doublet_cluster_attribute input fields)
    • For tSNE visualization, only support FIt-SNE algorithm. (see run_tsne and plot_tsne input fields)
    • Improve efficiency on log-normalization and DE tests.
    • Support multiple marker JSON files used in cell type annotation. (see organism input field)
    • More preset gene sets provided in gene score calculation. (see calc_signature_scores input field)
  • Add star_solo workflow (see STARsolo section for details):
    • Use STARsolo to generate count matrices from FASTQ files.
    • Support chemistry protocols such as 10X-V3, 10X-V2, DropSeq, and SeqWell.
  • Update the example of analyzing hashing and CITE-Seq data (see Example section) with the new workflows.
  • Bug fix.

Version 1.0.0 September 23, 2020

  • Add demultiplexing workflow for cell-hashing/nucleus-hashing/genetic-pooling analysis.
  • Add support on CellRanger version 4.0.0.
  • Update cumulus workflow with Pegasus version 1.0.0:
    • Use zarr file format to handle data, which has a better I/O performance in general.
    • Support focus analysis on Unimodal data, and appending other Unimodal data to it. (focus and append inputs in cluster step).
    • Quality-Control: Change percent_mito default from 10.0 to 20.0; by default remove bounds on UMIs (min_umis and max_umis inputs in cluster step).
    • Quality-Control: Automatically figure out name prefix of mitochondrial genes for GRCh38 and mm10 genome reference data.
    • Support signature / gene module score calculation. (calc_signature_scores input in cluster step)
    • Add Scanorama method to batch correction. (correction_method input in cluster step).
    • Calculate UMAP embedding by default, instead of FIt-SNE.
    • Differential Expression (DE) analysis: remove inputs mwu and auc as they are calculated by default. And cell-type annotation uses MWU test result by default.
  • Remove cumulus_subcluster workflow.

Version 0.15.0 May 6, 2020

  • Update all workflows to OpenWDL version 1.0.
  • Cumulus now supports multi-job execution from Terra data table input.
  • Cumulus generates Cirrocumulus input in .cirro folder, instead of a huge .parquet file.

Version 0.14.0 February 28, 2020

  • Added support for gene-count matrices generation using alternative tools (STARsolo, Optimus, Salmon alevin, Kallisto BUStools).
  • Cumulus can process demultiplexed data with remapped singlets names and subset of singlets.
  • Update VDJ related inputs in Cellranger workflow.
  • SMART-Seq2 and Count workflows are in OpenWDL version 1.0.

Version 0.13.0 February 7, 2020

  • Added support for aggregating scATAC-seq samples.
  • Cumulus now accepts mtx format input.

Version 0.12.0 December 14, 2019

  • Added support for building references for sc/snRNA-seq, scATAC-seq, single-cell immune profiling, and SMART-Seq2 data.

Version 0.11.0 December 4, 2019

  • Reorganized Cumulus documentation.

Version 0.10.0 October 2, 2019

  • scCloud is renamed to Cumulus.
  • Cumulus can accept either a sample sheet or a single file.

Version 0.7.0 Feburary 14, 2019

  • Added support for 10x genomics scATAC assays.
  • scCloud runs FIt-SNE as default.

Version 0.6.0 January 31, 2019

  • Added support for 10x genomics V3 chemistry.
  • Added support for extracting feature matrix for Perturb-Seq data.
  • Added R script to convert output_name.seurat.h5ad to Seurat object. Now the raw.data slot stores filtered raw counts.
  • Added min_umis and max_umis to filter cells based on UMI counts.
  • Added QC plots and improved filtration spreadsheet.
  • Added support for plotting UMAP and FLE.
  • Now users can upload their JSON file to annotate cell types.
  • Improved documentation.
  • Added lightGBM based marker detection.

Version 0.5.0 November 18, 2018

  • Added support for plated-based SMART-Seq2 scRNA-Seq data.

Version 0.4.0 October 26, 2018

  • Added CITE-Seq module for analyzing CITE-Seq data.

Version 0.3.0 October 24, 2018

  • Added the demuxEM module for demultiplexing cell-hashing/nuclei-hashing data.

Version 0.2.0 October 19, 2018

  • Added support for V(D)J and CITE-Seq/cell-hashing/nuclei-hashing.

Version 0.1.0 July 27, 2018

  • KCO tools released!

First Time Running

Authenticate with Google

If you’ve done this before you can skip this step - you only need to do this once.

  1. Ensure the Google Cloud SDK is installed on your computer.

    Note: Broad users do not have to install this-they can type:

    reuse Google-Cloud-SDK
    

    to make the Google Cloud tools available.

  2. Execute the following command to login to Google Cloud.:

    gcloud auth login
    
  3. Copy and paste the link in your unix terminal into your web browser.

  4. Enter authorization code in unix terminal.


Create a Terra workspace

  1. Create a new Terra workspace by clicking Create New Workspace in Terra

    For more detailed instructions please see this document.

Latest and stable versions on Terra

Cumulus is a fast growing project. As a result, we frequently update WDL snapshot versions on Terra. See below for latest and stable WDL versions you can use.

Stable version - v1.2.0

WDL Snapshot Function
cumulus/cellranger_workflow 15 Run Cell Ranger tools, which include extracting sequence reads using cellranger mkfastq or cellranger-atac mkfastq, generating count matrix using cellranger count or cellranger-atac count, running cellranger vdj or feature-barcode extraction.
cumulus/spaceranger_workflow 1 Run Space Ranger tools to process spatial transcriptomics data, which includes extracting sequence reads using spaceranger mkfastq, and generating count matrix using spaceranger count.
cumulus/star_solo 3 Run STARsolo to generate gene-count matrices fro FASTQ files.
cumulus/count 18 Run alternative tools (STARsolo, Optimus, Salmon alevin, or Kallisto BUStools) to generate gene-count matrices from FASTQ files.
cumulus/demultiplexing 22 Run tools (demuxEM, souporcell, or demuxlet) for cell-hashing/nucleus-hashing/genetic-pooling analysis.
cumulus/cellranger_create_reference 9 Run Cell Ranger tools to build sc/snRNA-seq references.
cumulus/cellranger_atac_aggr 2 Run Cell Ranger tools to aggregate scATAC-seq samples.
cumulus/cellranger_atac_create_reference 2 Run Cell Ranger tools to build scATAC-seq references.
cumulus/cellranger_vdj_create_reference 3 Run Cell Ranger tools to build single-cell immune profiling references.
cumulus/smartseq2 7 Run HISAT2/STAR/Bowtie2-RSEM to generate gene-count matrices for SMART-Seq2 data from FASTQ files.
cumulus/smartseq2_create_reference 8 Generate user-customized genome references for SMART-Seq2 data.
cumulus/cumulus 35 Run cumulus analysis module for variable gene selection, batch correction, PCA, diffusion map, clustering, visualization, differential expression analysis, cell type annotation, etc.

Stable version - v1.1.0

WDL Snapshot Function
cumulus/cellranger_workflow 14 Run Cell Ranger tools, which include extracting sequence reads using cellranger mkfastq or cellranger-atac mkfastq, generate count matrix using cellranger count or cellranger-atac count, run cellranger vdj or feature-barcode extraction
cumulus/star_solo 3 Run STARsolo to generate gene-count matrices fro FASTQ files.
cumulus/count 16 Run alternative tools (STARsolo, Optimus, Salmon alevin, or Kallisto BUStools) to generate gene-count matrices from FASTQ files.
cumulus/demultiplexing 21 Run tools (demuxEM, souporcell, or demuxlet) for cell-hashing/nucleus-hashing/genetic-pooling analysis.
cumulus/cellranger_create_reference 9 Run Cell Ranger tools to build sc/snRNA-seq references.
cumulus/cellranger_atac_aggr 2 Run Cell Ranger tools to aggregate scATAC-seq samples.
cumulus/cellranger_atac_create_reference 2 Run Cell Ranger tools to build scATAC-seq references.
cumulus/cellranger_vdj_create_reference 3 Run Cell Ranger tools to build single-cell immune profiling references.
cumulus/smartseq2 7 Run HISAT2/STAR/Bowtie2-RSEM to generate gene-count matrices for SMART-Seq2 data from FASTQ files
cumulus/smartseq2_create_reference 8 Generate user-customized genome references for SMART-Seq2 data.
cumulus/cumulus 34 Run cumulus analysis module for variable gene selection, batch correction, PCA, diffusion map, clustering, visualization, differential expression analysis, cell type annotation, etc.

Stable version - v1.0.0

WDL Snapshot Function
cumulus/cellranger_workflow 12 Run Cell Ranger tools, which include extracting sequence reads using cellranger mkfastq or cellranger-atac mkfastq, generate count matrix using cellranger count or cellranger-atac count, run cellranger vdj or feature-barcode extraction
cumulus/count 14 Run alternative tools (STARsolo, Optimus, Salmon alevin, or Kallisto BUStools) to generate gene-count matrices from FASTQ files.
cumulus/demultiplexing 20 Run tools (demuxEM, souporcell, or demuxlet) for cell-hashing/nucleus-hashing/genetic-pooling analysis.
cumulus/cellranger_create_reference 9 Run Cell Ranger tools to build sc/snRNA-seq references.
cumulus/cellranger_atac_aggr 2 Run Cell Ranger tools to aggregate scATAC-seq samples.
cumulus/cellranger_atac_create_reference 2 Run Cell Ranger tools to build scATAC-seq references.
cumulus/cellranger_vdj_create_reference 3 Run Cell Ranger tools to build single-cell immune profiling references.
cumulus/smartseq2 7 Run HISAT2/STAR/Bowtie2-RSEM to generate gene-count matrices for SMART-Seq2 data from FASTQ files
cumulus/smartseq2_create_reference 8 Generate user-customized genome references for SMART-Seq2 data.
cumulus/cumulus 31 Run cumulus analysis module for variable gene selection, batch correction, PCA, diffusion map, clustering, visualization, differential expression analysis, cell type annotation, etc.
cumulus/cumulus_hashing_cite_seq 10 Run cumulus for cell-hashing/nucleus-hashing/CITE-Seq analysis

Stable version - v0.15.0

WDL Snapshot Function
cumulus/cellranger_workflow 10 Run Cell Ranger tools, which include extracting sequence reads using cellranger mkfastq or cellranger-atac mkfastq, generate count matrix using cellranger count or cellranger-atac count, run cellranger vdj or feature-barcode extraction
cumulus/count 14 Run alternative tools (STARsolo, Optimus, Salmon alevin, or Kallisto BUStools) to generate gene-count matrices from FASTQ files.
cumulus/cellranger_create_reference 8 Run Cell Ranger tools to build sc/snRNA-seq references.
cumulus/cellranger_atac_aggr 2 Run Cell Ranger tools to aggregate scATAC-seq samples.
cumulus/cellranger_atac_create_reference 2 Run Cell Ranger tools to build scATAC-seq references.
cumulus/cellranger_vdj_create_reference 2 Run Cell Ranger tools to build single-cell immune profiling references.
cumulus/smartseq2 7 Run HISAT2/STAR/Bowtie2-RSEM to generate gene-count matrices for SMART-Seq2 data from FASTQ files
cumulus/smartseq2_create_reference 8 Generate user-customized genome references for SMART-Seq2 data.
cumulus/cumulus 24 Run cumulus analysis module for variable gene selection, batch correction, PCA, diffusion map, clustering, visualization, differential expression analysis, cell type annotation, etc.
cumulus/cumulus_subcluster 16 Run subcluster analysis using cumulus
cumulus/cumulus_hashing_cite_seq 10 Run cumulus for cell-hashing/nucleus-hashing/CITE-Seq analysis

Stable version - v0.14.0

WDL Snapshot Function
cumulus/cellranger_workflow 8 Run Cell Ranger tools, which include extracting sequence reads using cellranger mkfastq or cellranger-atac mkfastq, generate count matrix using cellranger count or cellranger-atac count, run cellranger vdj or feature-barcode extraction
cumulus/count 11 Run alternative tools (STARsolo, Optimus, Salmon alevin, or Kallisto BUStools) to generate gene-count matrices from FASTQ files.
cumulus/cellranger_create_reference 6 Run Cell Ranger tools to build sc/snRNA-seq references.
cumulus/cellranger_atac_aggr 1 Run Cell Ranger tools to aggregate scATAC-seq samples.
cumulus/cellranger_atac_create_reference 1 Run Cell Ranger tools to build scATAC-seq references.
cumulus/cellranger_vdj_create_reference 1 Run Cell Ranger tools to build single-cell immune profiling references.
cumulus/smartseq2 7 Run HISAT2/STAR/Bowtie2-RSEM to generate gene-count matrices for SMART-Seq2 data from FASTQ files
cumulus/smartseq2_create_reference 8 Generate user-customized genome references for SMART-Seq2 data.
cumulus/cumulus 16 Run cumulus analysis module for variable gene selection, batch correction, PCA, diffusion map, clustering, visualization, differential expression analysis, cell type annotation, etc.
cumulus/cumulus_subcluster 10 Run subcluster analysis using cumulus
cumulus/cumulus_hashing_cite_seq 8 Run cumulus for cell-hashing/nucleus-hashing/CITE-Seq analysis

Stable version - v0.13.0

WDL Snapshot Function
cumulus/cellranger_workflow 7 Run Cell Ranger tools, which include extracting sequence reads using cellranger mkfastq or cellranger-atac mkfastq, generate count matrix using cellranger count or cellranger-atac count, run cellranger vdj or feature-barcode extraction
cumulus/cellranger_create_reference 1 Run Cell Ranger tools to build sc/snRNA-seq references.
cumulus/cellranger_atac_aggr 1 Run Cell Ranger tools to aggregate scATAC-seq samples.
cumulus/cellranger_atac_create_reference 1 Run Cell Ranger tools to build scATAC-seq references.
cumulus/cellranger_vdj_create_reference 1 Run Cell Ranger tools to build single-cell immune profiling references.
cumulus/smartseq2 5 Run Bowtie2 and RSEM to generate gene-count matrices for SMART-Seq2 data from FASTQ files
cumulus/smartseq2_create_reference 4 Generate user-customized genome references for SMART-Seq2 data.
cumulus/cumulus 14 Run cumulus analysis module for variable gene selection, batch correction, PCA, diffusion map, clustering, visualization, differential expression analysis, cell type annotation, etc.
cumulus/cumulus_subcluster 9 Run subcluster analysis using cumulus
cumulus/cumulus_hashing_cite_seq 7 Run cumulus for cell-hashing/nucleus-hashing/CITE-Seq analysis

Stable version - v0.12.0

WDL Snapshot Function
cumulus/cellranger_workflow 6 Run Cell Ranger tools, which include extracting sequence reads using cellranger mkfastq or cellranger-atac mkfastq, generate count matrix using cellranger count or cellranger-atac count, run cellranger vdj or feature-barcode extraction
cumulus/cellranger_create_reference 1 Run Cell Ranger tools to build sc/snRNA-seq references.
cumulus/cellranger_atac_create_reference 1 Run Cell Ranger tools to build scATAC-seq references.
cumulus/cellranger_vdj_create_reference 1 Run Cell Ranger tools to build single-cell immune profiling references.
cumulus/smartseq2 5 Run Bowtie2 and RSEM to generate gene-count matrices for SMART-Seq2 data from FASTQ files
cumulus/smartseq2_create_reference 4 Generate user-customized genome references for SMART-Seq2 workflow.
cumulus/cumulus 11 Run cumulus analysis module for variable gene selection, batch correction, PCA, diffusion map, clustering, visualization, differential expression analysis, cell type annotation, etc.
cumulus/cumulus_subcluster 8 Run subcluster analysis using cumulus
cumulus/cumulus_hashing_cite_seq 6 Run cumulus for cell-hashing/nucleus-hashing/CITE-Seq analysis

Stable version - v0.11.0

WDL Snapshot Function
cumulus/cellranger_workflow 4 Run Cell Ranger tools, which include extracting sequence reads using cellranger mkfastq or cellranger-atac mkfastq, generate count matrix using cellranger count or cellranger-atac count, run cellranger vdj or feature-barcode extraction
cumulus/smartseq2 3 Run Bowtie2 and RSEM to generate gene-count matrices for SMART-Seq2 data from FASTQ files
cumulus/cumulus 8 Run cumulus analysis module for variable gene selection, batch correction, PCA, diffusion map, clustering, visualization, differential expression analysis, cell type annotation, etc.
cumulus/cumulus_subcluster 5 Run subcluster analysis using cumulus
cumulus/cumulus_hashing_cite_seq 5 Run cumulus for cell-hashing/nucleus-hashing/CITE-Seq analysis

Stable version - v0.10.0

WDL Snapshot Function
cumulus/cellranger_workflow 3 Run Cell Ranger tools, which include extracting sequence reads using cellranger mkfastq or cellranger-atac mkfastq, generate count matrix using cellranger count or cellranger-atac count, run cellranger vdj or feature-barcode extraction
cumulus/smartseq2 3 Run Bowtie2 and RSEM to generate gene-count matrices for SMART-Seq2 data from FASTQ files
cumulus/cumulus 7 Run cumulus analysis module for variable gene selection, batch correction, PCA, diffusion map, clustering, visualization, differential expression analysis, cell type annotation, etc.
cumulus/cumulus_subcluster 4 Run subcluster analysis using cumulus
cumulus/cumulus_hashing_cite_seq 4 Run cumulus for cell-hashing/nucleus-hashing/CITE-Seq analysis

Stable version - HTAPP v2

WDL Snapshot Function
regev/cellranger_mkfastq_count 45 Run Cell Ranger to extract FASTQ files and generate gene-count matrices for 10x genomics data
scCloud/smartseq2 5 Run Bowtie2 and RSEM to generate gene-count matrices for SMART-Seq2 data from FASTQ files
scCloud/scCloud 14 Run scCloud analysis module for variable gene selection, batch correction, PCA, diffusion map, clustering and more
scCloud/scCloud_subcluster 9 Run subcluster analysis using scCloud
scCloud/scCloud_hashing_cite_seq 9 Run scCloud for cell-hashing/nucleus-hashing/CITE-Seq analysis

Stable version - HTAPP v1

WDL Snapshot Function
regev/cellranger_mkfastq_count 39 Run Cell Ranger to extract FASTQ files and generate gene-count matrices for 10x genomics data
scCloud/scCloud 3 Run scCloud analysis module for variable gene selection, batch correction, PCA, diffusion map, clustering and more

Run Cell Ranger tools using cellranger_workflow

cellranger_workflow wraps Cell Ranger to process single-cell/nucleus RNA-seq, single-cell ATAC-seq and single-cell immune profiling data, and supports feature barcoding (cell/nucleus hashing, CITE-seq, Perturb-seq). It also provide routines to build cellranger references.

A general step-by-step instruction

This section mainly considers jobs starting from BCL files. If your job starts with FASTQ files, and only need to run cellranger count part, please refer to this subsection.

1. Import cellranger_workflow

Import cellranger_workflow workflow to your workspace.

See the Terra documentation for adding a workflow. The cellranger_workflow workflow is under Broad Methods Repository with name “cumulus/cellranger_workflow”.

Moreover, in the workflow page, click the Export to Workspace... button, and select the workspace to which you want to export cellranger_workflow workflow in the drop-down menu.

2. Upload sequencing data to Google bucket

Copy your sequencing output to your workspace bucket using gsutil (you already have it if you’ve installed Google cloud SDK) in your unix terminal.

You can obtain your bucket URL in the dashboard tab of your Terra workspace under the information panel.

_images/google_bucket_link.png

Use gsutil cp [OPTION]... src_url dst_url to copy data to your workspace bucket. For example, the following command copies the directory at /foo/bar/nextseq/Data/VK18WBC6Z4 to a Google bucket:

gsutil -m cp -r /foo/bar/nextseq/Data/VK18WBC6Z4 gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4

-m means copy in parallel, -r means copy the directory recursively, and gs://fc-e0000000-0000-0000-0000-000000000000 should be replaced by your own workspace Google bucket URL.

Note

If input is a folder of BCL files, users do not need to upload the whole folder to the Google bucket. Instead, they only need to upload the following files:

RunInfo.xml
RTAComplete.txt
runParameters.xml
Data/Intensities/s.locs
Data/Intensities/BaseCalls

If data are generated using MiSeq or NextSeq, the location files are inside lane subfloders L001 under Data/Intensities/. In addition, if users’ data only come from a subset of lanes (e.g. L001 and L002), users only need to upload lane subfolders from the subset (e.g. Data/Intensities/BaseCalls/L001, Data/Intensities/BaseCalls/L002 and Data/Intensities/L001, Data/Intensities/L002 if sequencer is MiSeq or NextSeq).

Alternatively, users can submit jobs through command line interface (CLI) using altocumulus, which will smartly upload BCL folders according to the above rules.

Note

Broad users need to be on an UGER node (not a login node) in order to use the -m flag

Request an UGER node:

reuse UGER
qrsh -q interactive -l h_vmem=4g -pe smp 8 -binding linear:8 -P regevlab

The above command requests an interactive node with 4G memory per thread and 8 threads. Feel free to change the memory, thread, and project parameters.

Once you’re connected to an UGER node, you can make gsutil available by running:

reuse Google-Cloud-SDK
3. Prepare a sample sheet

3.1 Sample sheet format:

Please note that the columns in the CSV can be in any order, but that the column names must match the recognized headings.

The sample sheet describes how to demultiplex flowcells and generate channel-specific count matrices. Note that Sample, Lane, and Index columns are defined exactly the same as in 10x’s simple CSV layout file.

A brief description of the sample sheet format is listed below (required column headers are shown in bold).

Column Description
Sample Contains sample names. Each 10x channel should have a unique sample name.
Reference
Provides the reference genome used by Cell Ranger for each 10x channel.
The elements in the reference column can be either Google bucket URLs to reference tarballs or keywords such as GRCh38-2020-A.
A full list of available keywords is included in each of the following data type sections (e.g. sc/snRNA-seq) below.
Flowcell
Indicates the Google bucket URLs of uploaded BCL folders.
If starts with FASTQ files, this should be Google bucket URLs of uploaded FASTQ folders.
The FASTQ folders should contain one subfolder for each sample in the flowcell with the sample name as the subfolder name.
Each subfolder contains FASTQ files for that sample.
Lane
Tells which lanes the sample was pooled into.
Can be either single lane (e.g. 8) or a range (e.g. 7-8) or all (e.g. *).
Index Sample index (e.g. SI-GA-A12).
Chemistry Describes the 10x chemistry used for the sample. This column is optional.
DataType
Describes the data type of the sample — rna, vdj, adt, crispr, atac.
rna refers to gene expression data (cellranger count),
vdj refers to V(D)J data (cellranger vdj),
adt refers to antibody tag data, which can be either CITE-Seq, cell-hashing, or nucleus-hashing,
crispr refers to Perturb-seq guide tag data,
atac refers to scATAC-Seq data (cellranger-atac count),
This column is optional and the default data type is rna.
FeatureBarcodeFile
Google bucket urls pointing to feature barcode files for rna, adt and crispr data.
Features can be either targeted genes for targeted gene expression analysis, antibody for CITE-Seq, cell-hashing, nucleus-hashing or gRNA for Perburb-seq.
This column is only required for targeted gene expression analysis (rna), CITE-Seq, cell-hashing, nucleus-hashing (adt) and Perturb-seq (crispr).

The sample sheet supports sequencing the same 10x channels across multiple flowcells. If a sample is sequenced across multiple flowcells, simply list it in multiple rows, with one flowcell per row. In the following example, we have 4 samples sequenced in two flowcells.

Example:

Sample,Reference,Flowcell,Lane,Index,Chemistry,DataType
sample_1,GRCh38-2020-A,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,1-2,SI-GA-A8,threeprime,rna
sample_2,GRCh38-2020-A,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,3-4,SI-GA-B8,SC3Pv3,rna
sample_3,mm10-2020-A,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,5-6,SI-GA-C8,fiveprime,rna
sample_4,mm10-2020-A,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,7-8,SI-GA-D8,fiveprime,rna
sample_1,GRCh38-2020-A,gs://fc-e0000000-0000-0000-0000-000000000000/VK10WBC9Z2,1-2,SI-GA-A8,threeprime,rna
sample_2,GRCh38-2020-A,gs://fc-e0000000-0000-0000-0000-000000000000/VK10WBC9Z2,3-4,SI-GA-B8,SC3Pv3,rna
sample_3,mm10-2020-A,gs://fc-e0000000-0000-0000-0000-000000000000/VK10WBC9Z2,5-6,SI-GA-C8,fiveprime,rna
sample_4,mm10-2020-A,gs://fc-e0000000-0000-0000-0000-000000000000/VK10WBC9Z2,7-8,SI-GA-D8,fiveprime,rna

3.2 Upload your sample sheet to the workspace bucket:

Example:

gsutil cp /foo/bar/projects/sample_sheet.csv gs://fc-e0000000-0000-0000-0000-000000000000/
4. Launch analysis

In your workspace, open cellranger_workflow in WORKFLOWS tab. Select the desired snapshot version (e.g. latest). Select Run workflow with inputs defined by file paths as below

_images/single_workflow.png

and click SAVE button. Select Use call caching and click INPUTS. Then fill in appropriate values in the Attribute column. Alternative, you can upload a JSON file to configure input by clicking Drag or click to upload json.

Once INPUTS are appropriated filled, click RUN ANALYSIS and then click LAUNCH.

5. Notice: run cellranger mkfastq if you are non Broad Institute users

Non Broad Institute users that wish to run cellranger mkfastq must create a custom docker image that contains bcl2fastq.

See bcl2fastq instructions.
6. Run cellranger count only

Sometimes, users might want to perform demultiplexing locally and only run the count part on the cloud. This section describes how to only run the count part via cellranger_workflow.

  1. Copy your FASTQ files to the workspace using gsutil in your unix terminal.

    You should upload folders of FASTQ files. The uploaded folder (for one flowcell) should contain one subfolder for each sample belong to the this flowcell. In addition, the subfolder name and the sample name in your sample sheet MUST be the same. Each subfolder contains FASTQ files for that sample. Please note that if your FASTQ file are downloaded from the Sequence Read Archive (SRA) from NCBI, you must rename your FASTQs to follow the bcl2fastq file naming conventions.

    Example:

    gsutil -m cp -r /foo/bar/fastq_path/K18WBC6Z4 gs://fc-e0000000-0000-0000-0000-000000000000/K18WBC6Z4_fastq
    
  2. Create a sample sheet following the similar structure as above, except the following differences:

    • Flowcell column should list Google bucket URLs of the FASTQ folders for flowcells.
    • Lane and Index columns are NOT required in this case.

    Example:

    Sample,Reference,Flowcell
    sample_1,GRCh38-2020-A,gs://fc-e0000000-0000-0000-0000-000000000000/K18WBC6Z4_fastq
    
  3. Set optional input run_mkfastq to false.


Single-cell and single-nucleus RNA-seq

To process sc/snRNA-seq data, follow the specific instructions below.

Sample sheet
  1. Reference column.

    Pre-built scRNA-seq references are summarized below.

    Keyword Description
    GRCh38-2020-A Human GRCh38 (GENCODE v32/Ensembl 98)
    mm10-2020-A Mouse mm10 (GENCODE vM23/Ensembl 98)
    GRCh38_and_mm10-2020-A Human GRCh38 (GENCODE v32/Ensembl 98) and mouse mm10 (GENCODE vM23/Ensembl 98)
    GRCh38_v3.0.0 Human GRCh38, cellranger reference 3.0.0, Ensembl v93 gene annotation
    hg19_v3.0.0 Human hg19, cellranger reference 3.0.0, Ensembl v87 gene annotation
    mm10_v3.0.0 Mouse mm10, cellranger reference 3.0.0, Ensembl v93 gene annotation
    GRCh38_and_mm10_v3.1.0 Human (GRCh38) and mouse (mm10), cellranger references 3.1.0, Ensembl v93 gene annotations for both human and mouse
    hg19_and_mm10_v3.0.0 Human (hg19) and mouse (mm10), cellranger reference 3.0.0, Ensembl v93 gene annotations for both human and mouse
    GRCh38_v1.2.0 or GRCh38 Human GRCh38, cellranger reference 1.2.0, Ensembl v84 gene annotation
    hg19_v1.2.0 or hg19 Human hg19, cellranger reference 1.2.0, Ensembl v82 gene annotation
    mm10_v1.2.0 or mm10 Mouse mm10, cellranger reference 1.2.0, Ensembl v84 gene annotation
    GRCh38_and_mm10_v1.2.0 or GRCh38_and_mm10 Human and mouse, built from GRCh38 and mm10 cellranger references, Ensembl v84 gene annotations are used
    GRCh38_and_SARSCoV2 Human GRCh38 and SARS-COV-2 RNA genome, cellranger reference 3.0.0, generated by Carly Ziegler. The SARS-COV-2 viral sequence and gtf are as described in [Kim et al. Cell 2020] (https://github.com/hyeshik/sars-cov-2-transcriptome, BetaCov/South Korea/KCDC03/2020 based on NC_045512.2). The GTF was edited to include only CDS regions, and regions were added to describe the 5’ UTR (“SARSCoV2_5prime”), the 3’ UTR (“SARSCoV2_3prime”), and reads aligning to anywhere within the Negative Strand(“SARSCoV2_NegStrand”). Additionally, trailing A’s at the 3’ end of the virus were excluded from the SARSCoV2 fasta, as these were found to drive spurious viral alignment in pre-COVID19 samples.

    Pre-built snRNA-seq references are summarized below.

    Keyword Description
    GRCh38_premrna_v3.0.0 Human, introns included, built from GRCh38 cellranger reference 3.0.0, Ensembl v93 gene annotation, treating annotated transcripts as exons
    GRCh38_premrna_v1.2.0 or GRCh38_premrna Human, introns included, built from GRCh38 cellranger reference 1.2.0, Ensembl v84 gene annotation, treating annotated transcripts as exons
    mm10_premrna_v1.2.0 or mm10_premrna Mouse, introns included, built from mm10 cellranger reference 1.2.0, Ensembl v84 gene annotation, treating annotated transcripts as exons
    GRCh38_premrna_and_mm10_premrna_v1.2.0 or GRCh38_premrna_and_mm10_premrna Human and mouse, introns included, built from GRCh38_premrna_v1.2.0 and mm10_premrna_v1.2.0
    GRCh38_premrna_and_SARSCoV2 Human, introns included, built from GRCh38_premrna_v3.0.0, and SARS-COV-2 RNA genome. This reference was generated by Carly Ziegler. The SARS-COV-2 RNA genome is from [Kim et al. Cell 2020] (https://github.com/hyeshik/sars-cov-2-transcriptome, BetaCov/South Korea/KCDC03/2020 based on NC_045512.2). Please see the description of GRCh38_and_SARSCoV2 above for details.
  2. Index column.

  3. Chemistry column.

    According to cellranger count’s documentation, chemistry can be

    Chemistry Explanation
    auto autodetection (default). If the index read has extra bases besides cell barcode and UMI, autodetection might fail. In this case, please specify the chemistry
    threeprime Single Cell 3′
    fiveprime Single Cell 5′
    SC3Pv1 Single Cell 3′ v1
    SC3Pv2 Single Cell 3′ v2
    SC3Pv3 Single Cell 3′ v3. You should set cellranger version input parameter to >= 3.0.2
    SC5P-PE Single Cell 5′ paired-end (both R1 and R2 are used for alignment)
    SC5P-R2 Single Cell 5′ R2-only (where only R2 is used for alignment)
  4. DataType column.

    This column is optional with a default rna. If you want to put a value, put rna here.

  5. FetureBarcodeFile column.

    Put target panel CSV file here for targeted expressiond data. Note that if a target panel CSV is present, cell ranger version must be >= 4.0.0.

  6. Example:

    Sample,Reference,Flowcell,Lane,Index,Chemistry,DataType,FeatureBarcodeFile
    sample_1,GRCh38-2020-A,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,1-2,SI-GA-A8,threeprime,rna
    sample_1,GRCh38-2020-A,gs://fc-e0000000-0000-0000-0000-000000000000/VK10WBC9Z2,1-2,SI-GA-A8,threeprime,rna
    sample_2,mm10-2020-A,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,5-6,SI-GA-C8,fiveprime,rna
    sample_2,mm10-2020-A,gs://fc-e0000000-0000-0000-0000-000000000000/VK10WBC9Z2,5-6,SI-GA-C8,fiveprime,rna
    sample_3,GRCh38-2020-A,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,3,SI-TT-A1,auto,rna,gs://fc-e0000000-0000-0000-0000-000000000000/immunology_v1.0_GRCh38-2020-A.target_panel.csv
    
Workflow input

For sc/snRNA-seq data, cellranger_workflow takes Illumina outputs as input and runs cellranger mkfastq and cellranger count. Revalant workflow inputs are described below, with required inputs highlighted in bold.

Name Description Example Default
input_csv_file Sample Sheet (contains Sample, Reference, Flowcell, Lane, Index as required and Chemistry, DataType, FeatureBarcodeFile as optional) “gs://fc-e0000000-0000-0000-0000-000000000000/sample_sheet.csv”  
output_directory Output directory “gs://fc-e0000000-0000-0000-0000-000000000000/cellranger_output” Results are written under directory output_directory and will overwrite any existing files at this location.
run_mkfastq If you want to run cellranger mkfastq true true
run_count If you want to run cellranger count true true
delete_input_bcl_directory If delete BCL directories after demux. If false, you should delete this folder yourself so as to not incur storage charges false false
mkfastq_barcode_mismatches Number of mismatches allowed in matching barcode indices (bcl2fastq2 default is 1) 0  
force_cells Force pipeline to use this number of cells, bypassing the cell detection algorithm, mutually exclusive with expect_cells 6000  
expect_cells Expected number of recovered cells. Mutually exclusive with force_cells 3000  
include_introns Turn this option on to also count reads mapping to intronic regions. With this option, users do not need to use pre-mRNA references. Note that if this option is set, cellranger_version must be >= 5.0.0. false false
no_bam Turn this option on to disable BAM file generation. This option is only available if cellranger_version >= 5.0.0. false false
secondary Perform Cell Ranger secondary analysis (dimensionality reduction, clustering, etc.) false false
cellranger_version cellranger version, could be 5.0.1, 5.0.0, 4.0.0, 3.1.0, 3.0.2, or 2.2.0 “5.0.1” “5.0.1”
config_version config docker version used for processing sample sheets, could be 0.2, 0.1 “0.2” “0.2”
docker_registry

Docker registry to use for cellranger_workflow. Options:

  • “quay.io/cumulus” for images on Red Hat registry;
  • “cumulusprod” for backup images on Docker Hub.
“quay.io/cumulus” “quay.io/cumulus”
cellranger_mkfastq_docker_registry Docker registry to use for cellranger mkfastq. Default is the registry to which only Broad users have access. See bcl2fastq for making your own registry. “gcr.io/broad-cumulus” “gcr.io/broad-cumulus”
zones Google cloud zones “us-central1-a us-west1-a” “us-central1-a us-central1-b us-central1-c us-central1-f us-east1-b us-east1-c us-east1-d us-west1-a us-west1-b us-west1-c”
num_cpu Number of cpus to request for one node for cellranger mkfastq and cellranger count 32 32
memory Memory size string for cellranger mkfastq and cellranger count “120G” “120G”
mkfastq_disk_space Optional disk space in GB for mkfastq 1500 1500
count_disk_space Disk space in GB needed for cellranger count 500 500
preemptible Number of preemptible tries 2 2
Workflow output

See the table below for important sc/snRNA-seq outputs.

Name Type Description
output_fastqs_directory Array[String] A list of google bucket urls containing FASTQ files, one url per flowcell.
output_count_directory Array[String] A list of google bucket urls containing count matrices, one url per sample.
metrics_summaries File A excel spreadsheet containing QCs for each sample.
output_web_summary Array[File] A list of htmls visualizing QCs for each sample (cellranger count output).
count_matrix String gs url for a template count_matrix.csv to run Cumulus.

Feature barcoding assays (cell & nucleus hashing, CITE-seq and Perturb-seq)

cellranger_workflow can extract feature-barcode count matrices in CSV format for feature barcoding assays such as cell and nucleus hashing, CITE-seq, and Perturb-seq. For cell and nucleus hashing as well as CITE-seq, the feature refers to antibody. For Perturb-seq, the feature refers to guide RNA. Please follow the instructions below to configure cellranger_workflow.

Prepare feature barcode files

Prepare a CSV file with the following format: feature_barcode,feature_name. See below for an example:

TTCCTGCCATTACTA,sample_1
CCGTACCTCATTGTT,sample_2
GGTAGATGTCCTCAG,sample_3
TGGTGTCATTCTTGA,sample_4

The above file describes a cell hashing application with 4 samples.

If cell hashing and CITE-seq data share a same sample index, you should concatenate hashing and CITE-seq barcodes together and add a third column indicating the feature type. See below for an example:

TTCCTGCCATTACTA,sample_1,hashing
CCGTACCTCATTGTT,sample_2,hashing
GGTAGATGTCCTCAG,sample_3,hashing
TGGTGTCATTCTTGA,sample_4,hashing
CTCATTGTAACTCCT,CD3,citeseq
GCGCAACTTGATGAT,CD8,citeseq

Then upload it to your google bucket:

gsutil antibody_index.csv gs://fc-e0000000-0000-0000-0000-000000000000/antibody_index.csv
Sample sheet
  1. Reference column.

    This column is not used for extracting feature-barcode count matrix. To be consistent, please put the reference for the associated scRNA-seq assay here.

  2. Index column.

    The ADT/HTO index can be either Illumina index primer sequence (e.g. ATTACTCG, also known as D701), or 10x single cell RNA-seq sample index set names (e.g. SI-GA-A12).

    Note 1: All ADT/HTO index sequences (including 10x’s) should have the same length (8 bases). If one index sequence is shorter (e.g. ATCACG), pad it with P7 sequence (e.g. ATCACGAT).

    Note 2: It is users’ responsibility to avoid index collision between 10x genomics’ RNA indexes (e.g. SI-GA-A8) and Illumina index sequences for used here (e.g. ATTACTCG).

    Note 3: For NextSeq runs, please reverse complement the ADT/HTO index primer sequence (e.g. use reverse complement CGAGTAAT instead of ATTACTCG).

  3. Chemistry column.

    The following keywords are accepted for Chemistry column:

    Chemistry Explanation
    SC3Pv3 Single Cell 3′ v3 (default).
    SC3Pv2 Single Cell 3′ v2
    fiveprime Single Cell 5′
    SC5P-PE Single Cell 5′ paired-end (both R1 and R2 are used for alignment)
    SC5P-R2 Single Cell 5′ R2-only (where only R2 is used for alignment)
  4. DataType column.

    Put adt here if the assay is CITE-seq, cell or nucleus hashing. Put crispr here if Perturb-seq.

  5. FetureBarcodeFile column.

    Put Google Bucket URL of the feature barcode file here.

  6. Example:

    Sample,Reference,Flowcell,Lane,Index,Chemistry,DataType,FeatureBarcodeFile
    sample_1_rna,GRCh38_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,1-2,SI-GA-A8,threeprime,rna
    sample_1_adt,GRCh38_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,1-2,ATTACTCG,threeprime,adt,gs://fc-e0000000-0000-0000-0000-000000000000/antibody_index.csv
    sample_2_adt,GRCh38_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,3-4,TCCGGAGA,SC3Pv3,adt,gs://fc-e0000000-0000-0000-0000-000000000000/antibody_index.csv
    sample_3_crispr,GRCh38_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,5-6,CGCTCATT,SC3Pv3,crispr,gs://fc-e0000000-0000-0000-0000-000000000000/crispr_index.csv
    

In the sample sheet above, despite the header row,

  • First row describes the normal 3’ RNA assay;
  • Second row describes its associated antibody tag data, which can from either a CITE-seq, cell hashing, or nucleus hashing experiment.
  • Third row describes another tag data, which is in 10x genomics’ V3 chemistry. For tag and crispr data, it is important to explicitly state the chemistry (e.g. SC3Pv3).
  • Last row describes one gRNA guide data for Perturb-seq (see crispr in DataType field).
Workflow input

For feature barcoding data, cellranger_workflow takes Illumina outputs as input and runs cellranger mkfastq and cumulus adt. Revalant workflow inputs are described below, with required inputs highlighted in bold.

Name Description Example Default
input_csv_file Sample Sheet (contains Sample, Reference, Flowcell, Lane, Index as required and Chemistry, DataType, FeatureBarcodeFile as optional) “gs://fc-e0000000-0000-0000-0000-000000000000/sample_sheet.csv”  
output_directory Output directory “gs://fc-e0000000-0000-0000-0000-000000000000/cellranger_output”  
run_mkfastq If you want to run cellranger mkfastq true true
delete_input_directory If delete BCL directories after demux. If false, you should delete this folder yourself so as to not incur storage charges false false
mkfastq_barcode_mismatches Number of mismatches allowed in matching barcode indices (bcl2fastq2 default is 1) 0  
scaffold_sequence Scaffold sequence in sgRNA for Purturb-seq, only used for crispr data type. If it is “”, we assume guide barcode starts at position 0 of read 2 “GTTTAAGAGCTAAGCTGGAA” “”
max_mismatch Maximum hamming distance in feature barcodes for the adt task 3 3
min_read_ratio Minimum read count ratio (non-inclusive) to justify a feature given a cell barcode and feature combination, only used for the adt task and crispr data type 0.1 0.1
cellranger_version cellranger version, could be 4.0.0, 3.1.0, 3.0.2, 2.2.0 “4.0.0” “4.0.0”
cumulus_feature_barcoding_version Cumulus_feature_barcoding version for extracting feature barcode matrix. Version available: 0.3.0, 0.2.0. “0.3.0” “0.3.0”
docker_registry

Docker registry to use for cellranger_workflow. Options:

  • “quay.io/cumulus” for images on Red Hat registry;
  • “cumulusprod” for backup images on Docker Hub.
“quay.io/cumulus” “quay.io/cumulus”
mkfastq_docker_registry Docker registry to use for cellranger mkfastq. Default is the registry to which only Broad users have access. See bcl2fastq for making your own registry. “gcr.io/broad-cumulus” “gcr.io/broad-cumulus”
zones Google cloud zones “us-central1-a us-west1-a” “us-central1-a us-central1-b us-central1-c us-central1-f us-east1-b us-east1-c us-east1-d us-west1-a us-west1-b us-west1-c”
num_cpu Number of cpus to request for one node for cellranger mkfastq 32 32
memory Memory size string for cellranger mkfastq “120G” “120G”
feature_memory Optional memory string for extracting feature count matrix “32G” “32G”
mkfastq_disk_space Optional disk space in GB for mkfastq 1500 1500
feature_disk_space Disk space in GB needed for extracting feature count matrix 100 100
preemptible Number of preemptible tries 2 2
Parameters used for feature count matrix extraction

If the chemistry is V2, 10x genomics v2 cell barcode white list will be used, a hamming distance of 1 is allowed for matching cell barcodes, and the UMI length is 10. If the chemistry is V3, 10x genomics v3 cell barcode white list will be used, a hamming distance of 0 is allowed for matching cell barcodes, and the UMI length is 12.

For Perturb-seq data, a small number of sgRNA protospace sequences will be sequenced ultra-deeply and we may have PCR chimeric reads. Therefore, we generate filtered feature count matrices as well in a data driven manner:

  1. First, plot the histogram of UMIs with certain number of read counts. The number of UMIs with x supporting reads decreases when x increases. We start from x = 1, and a valley between two peaks is detected if we find count[x] < count[x + 1] < count[x + 2]. We filter out all UMIs with < x supporting reads since they are likely formed due to chimeric reads.
  2. In addition, we also filter out barcode-feature-UMI combinations that have their read count ratio, which is defined as total reads supporting barcode-feature-UMI over total reads supporting barcode-UMI, no larger than min_read_ratio parameter set above.
Workflow outputs

See the table below for important outputs.

Name Type Description
output_fastqs_directory Array[String] A list of google bucket urls containing FASTQ files, one url per flowcell.
output_count_directory Array[String] A list of google bucket urls containing feature-barcode count matrices, one url per sample.
count_matrix String gs url for a template count_matrix.csv to run cumulus.

In addition, For each antibody tag or crispr tag sample, a folder with the sample ID is generated under output_directory. In the folder, two files — sample_id.csv and sample_id.stat.csv.gz — are generated.

sample_id.csv is the feature count matrix. It has the following format. The first line describes the column names: Antibody/CRISPR,cell_barcode_1,cell_barcode_2,...,cell_barcode_n. The following lines describe UMI counts for each feature barcode, with the following format: feature_name,umi_count_1,umi_count_2,...,umi_count_n.

sample_id.stat.csv.gz stores the gzipped sufficient statistics. It has the following format. The first line describes the column names: Barcode,UMI,Feature,Count. The following lines describe the read counts for every barcode-umi-feature combination.

If the feature barcode file has a third column, there will be two files for each feature type in the third column. For example, if hashing presents, sample_id.hashing.csv and sample_id.hashing.stat.csv.gz will be generated.

If data type is crispr, three additional files, sample_id.umi_count.pdf, sample_id.filt.csv and sample_id.filt.stat.csv.gz, are generated.

sample_id.umi_count.pdf plots number of UMIs against UMI with certain number of reads and colors UMIs with high likelihood of being chimeric in blue and other UMIs in red. This plot is generated purely based on number of reads each UMI has.

sample_id.filt.csv is the filtered feature count matrix. It has the same format as sample_id.csv.

sample_id.filt.stat.csv.gz is the filtered sufficient statistics. It has the same format as sample_id.stat.csv.gz.


Single-cell ATAC-seq

To process scATAC-seq data, follow the specific instructions below.

Sample sheet
  1. Reference column.

    Pre-built scATAC-seq references are summarized below.

    Keyword Description
    GRCh38_atac_v1.2.0 Human GRCh38, cellranger-atac reference 1.2.0
    mm10_atac_v1.2.0 Mouse mm10, cellranger-atac reference 1.2.0
    hg19_atac_v1.2.0 Human hg19, cellranger-atac reference 1.2.0
    b37_atac_v1.2.0 Human b37 build, cellranger-atac reference 1.2.0
    GRCh38_and_mm10_atac_v1.2.0 Human GRCh38 and mouse mm10, cellranger-atac reference 1.2.0
    hg19_and_mm10_atac_v1.2.0 Human hg19 and mouse mm10, cellranger-atac reference 1.2.0
    GRCh38_atac_v1.1.0 Human GRCh38, cellranger-atac reference 1.1.0
    mm10_atac_v1.1.0 Mouse mm10, cellranger-atac reference 1.1.0
    hg19_atac_v1.1.0 Human hg19, cellranger-atac reference 1.1.0
    b37_atac_v1.1.0 Human b37 build, cellranger-atac reference 1.1.0
    GRCh38_and_mm10_atac_v1.1.0 Human GRCh38 and mouse mm10, cellranger-atac reference 1.1.0
    hg19_and_mm10_atac_v1.1.0 Human hg19 and mouse mm10, cellranger-atac reference 1.1.0
  2. Index column.

  3. Chemistry column.

    This column is not used for scATAC-seq data. Put auto here as a placeholder if you decide to include the Chemistry column.

  4. DataType column.

    Set it to atac.

  5. FetureBarcodeFile column.

    Leave it blank for scATAC-seq.

  6. Example:

    Sample,Reference,Flowcell,Lane,Index,Chemistry,DataType
    sample_atac,GRCh38_atac_v1.1.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK10WBC9YB,*,SI-NA-A1,auto,atac
    
Workflow input

cellranger_workflow takes Illumina outputs as input and runs cellranger-atac mkfastq and cellranger-atac count. Please see the description of inputs below. Note that required inputs are shown in bold.

Name Description Example Default
input_csv_file Sample Sheet (contains Sample, Reference, Flowcell, Lane, Index as required and Chemistry, DataType, FeatureBarcodeFile as optional) “gs://fc-e0000000-0000-0000-0000-000000000000/sample_sheet.csv”  
output_directory Output directory “gs://fc-e0000000-0000-0000-0000-000000000000/cellranger_output”  
run_mkfastq If you want to run cellranger-atac mkfastq true true
run_count If you want to run cellranger-atac count true true
delete_input_directory If delete BCL directories after demux. If false, you should delete this folder yourself so as to not incur storage charges false false
mkfastq_barcode_mismatches Number of mismatches allowed in matching barcode indices (bcl2fastq2 default is 1) 0  
force_cells Force pipeline to use this number of cells, bypassing the cell detection algorithm 6000  
cellranger_atac_version cellranger-atac version. Available options: 1.2.0, 1.1.0 “1.2.0” “1.2.0”
docker_registry

Docker registry to use for cellranger_workflow. Options:

  • “quay.io/cumulus” for images on Red Hat registry;
  • “cumulusprod” for backup images on Docker Hub.
“quay.io/cumulus” “quay.io/cumulus”
zones Google cloud zones “us-central1-a us-west1-a” “us-central1-a us-central1-b us-central1-c us-central1-f us-east1-b us-east1-c us-east1-d us-west1-a us-west1-b us-west1-c”
atac_num_cpu Number of cpus for cellranger-atac count 64 64
atac_memory Memory string for cellranger-atac count “57.6G” “57.6G”
mkfastq_disk_space Optional disk space in GB for cellranger-atac mkfastq 1500 1500
atac_disk_space Disk space in GB needed for cellranger-atac count 500 500
preemptible Number of preemptible tries 2 2
Workflow output

See the table below for important scATAC-seq outputs.

Name Type Description
output_fastqs_directory Array[String] A list of google bucket urls containing FASTQ files, one url per flowcell.
output_count_directory Array[String] A list of google bucket urls containing cellranger-atac count outputs, one url per sample.
metrics_summaries File A excel spreadsheet containing QCs for each sample.
output_web_summary Array[File] A list of htmls visualizing QCs for each sample (cellranger count output).
count_matrix String gs url for a template count_matrix.csv to run cumulus.
Aggregate scATAC-Seq Samples

To aggregate multiple scATAC-Seq samples, follow the instructions below:

  1. Import cellranger_atac_aggr workflow. Please see Step 1 here, and the name of workflow is “cumulus/cellranger_atac_aggr”.
  2. Set the inputs of workflow. Please see the description of inputs below. Notice that required inputs are shown in bold:
Name Description Example Default
aggr_id Aggregate ID. “aggr_sample”  
input_counts_directories A string contains comma-separated URLs to directories of samples to be aggregated. “gs://fc-e0000000-0000-0000-0000-000000000000/data/sample1,gs://fc-e0000000-0000-0000-0000-000000000000/data/sample2”  
output_directory Output directory “gs://fc-e0000000-0000-0000-0000-000000000000/aggregate_result”  
genome The reference genome name used by Cell Ranger, can be either a keyword of pre-built genome, or a Google Bucket URL. See this table for the list of keywords of pre-built genomes. “GRCh38_atac_v1.2.0”  
normalize Sample normalization mode. Options are: none, depth, or signal. “none” “none”
secondary Perform secondary analysis (dimensionality reduction, clustering and visualization). false false
dim_reduce Chose the algorithm for dimensionality reduction prior to clustering and tsne. Options are: lsa, plsa, or pca. “lsa” “lsa”
cellranger_atac_version Cell Ranger ATAC version to use. Options: 1.2.0, 1.1.0. “1.2.0” “1.2.0”
zones Google cloud zones “us-central1-a us-west1-a” “us-central1-b”
num_cpu Number of cpus to request for cellranger atac aggr. 64 64
memory Memory size string for cellranger atac aggr. “57.6G” “57.6G”
disk_space Disk space in GB needed for cellranger atac aggr. 500 500
preemptible Number of preemptible tries. 2 2
docker_registry

Docker registry to use for cellranger_workflow. Options:

  • “quay.io/cumulus” for images on Red Hat registry;
  • “cumulusprod” for backup images on Docker Hub.
“quay.io/cumulus” “quay.io/cumulus”
  1. Check out the output in output_directory/aggr_id folder, where output_directory and aggr_id are the inputs you set in Step 2.

Single-cell immune profiling

To process single-cell immune profiling (scIR-seq) data, follow the specific instructions below.

Sample sheet
  1. Reference column.

    Pre-built scIR-seq references are summarized below.

    Keyword Description
    GRCh38_vdj_v5.0.0 Human GRCh38 V(D)J sequences, cellranger reference 5.0.0, annotation built from Ensembl Homo_sapiens.GRCh38.94.chr_patch_hapl_scaff.gtf
    GRCm38_vdj_v5.0.0 Mouse GRCm38 V(D)J sequences, cellranger reference 5.0.0, annotation built from Ensembl Mus_musculus.GRCm38.94.gtf
    GRCh38_vdj_v4.0.0 Human GRCh38 V(D)J sequences, cellranger reference 4.0.0, annotation built from Ensembl Homo_sapiens.GRCh38.94.chr_patch_hapl_scaff.gtf
    GRCm38_vdj_v4.0.0 Mouse GRCm38 V(D)J sequences, cellranger reference 4.0.0, annotation built from Ensembl Mus_musculus.GRCm38.94.gtf
    GRCh38_vdj_v3.1.0 Human GRCh38 V(D)J sequences, cellranger reference 3.1.0, annotation built from Ensembl Homo_sapiens.GRCh38.94.chr_patch_hapl_scaff.gtf
    GRCm38_vdj_v3.1.0 Mouse GRCm38 V(D)J sequences, cellranger reference 3.1.0, annotation built from Ensembl Mus_musculus.GRCm38.94.gtf
    GRCh38_vdj_v2.0.0 or GRCh38_vdj Human GRCh38 V(D)J sequences, cellranger reference 2.0.0, annotation built from Ensembl Homo_sapiens.GRCh38.87.chr_patch_hapl_scaff.gtf and vdj_GRCh38_alts_ensembl_10x_genes-2.0.0.gtf
    GRCm38_vdj_v2.2.0 or GRCm38_vdj Mouse GRCm38 V(D)J sequences, cellranger reference 2.2.0, annotation built from Ensembl Mus_musculus.GRCm38.90.chr_patch_hapl_scaff.gtf
  2. Index column.

  3. Chemistry column.

    This column is not used for scIR-seq data. Put fiveprime here as a placeholder if you decide to include the Chemistry column.

  4. DataType column.

    Set it to vdj.

  5. FetureBarcodeFile column.

    Leave it blank for scIR-seq.

  6. Example:

    Sample,Reference,Flowcell,Lane,Index,Chemistry,DataType
    sample_vdj,GRCh38_vdj_v3.1.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK10WBC9ZZ,1,SI-GA-A1,fiveprime,vdj
    
Workflow input

For scIR-seq data, cellranger_workflow takes Illumina outputs as input and runs cellranger mkfastq and cellranger vdj. Revalant workflow inputs are described below, with required inputs highlighted in bold.

Name Description Example Default
input_csv_file Sample Sheet (contains Sample, Reference, Flowcell, Lane, Index as required and Chemistry, DataType, FeatureBarcodeFile as optional) “gs://fc-e0000000-0000-0000-0000-000000000000/sample_sheet.csv”  
output_directory Output directory “gs://fc-e0000000-0000-0000-0000-000000000000/cellranger_output”  
run_mkfastq If you want to run cellranger mkfastq true true
delete_input_directory If delete BCL directories after demux. If false, you should delete this folder yourself so as to not incur storage charges false false
mkfastq_barcode_mismatches Number of mismatches allowed in matching barcode indices (bcl2fastq2 default is 1) 0  
vdj_denovo Do not align reads to reference V(D)J sequences before de novo assembly false false
vdj_chain

Force the analysis to be carried out for a particular chain type. The accepted values are:

  • “auto” for auto detection based on TR vs IG representation;
  • “TR” for T cell receptors;
  • “IG” for B cell receptors.
“auto” “auto”
cellranger_version cellranger version, could be 4.0.0, 3.1.0, 3.0.2, 2.2.0 “4.0.0” “4.0.0”
docker_registry

Docker registry to use for cellranger_workflow. Options:

  • “quay.io/cumulus” for images on Red Hat registry;
  • “cumulusprod” for backup images on Docker Hub.
“quay.io/cumulus” “quay.io/cumulus”
cellranger_mkfastq_docker_registry Docker registry to use for cellranger mkfastq. Default is the registry to which only Broad users have access. See bcl2fastq for making your own registry. “gcr.io/broad-cumulus” “gcr.io/broad-cumulus”
zones Google cloud zones “us-central1-a us-west1-a” “us-central1-a us-central1-b us-central1-c us-central1-f us-east1-b us-east1-c us-east1-d us-west1-a us-west1-b us-west1-c”
num_cpu Number of cpus to request for one node for cellranger mkfastq and cellranger vdj 32 32
memory Memory size string for cellranger mkfastq and cellranger vdj “120G” “120G”
mkfastq_disk_space Optional disk space in GB for mkfastq 1500 1500
vdj_disk_space Disk space in GB needed for cellranger vdj 500 500
preemptible Number of preemptible tries 2 2
Workflow output

See the table below for important scIR-seq outputs.

Name Type Description
output_fastqs_directory Array[String] A list of google bucket urls containing FASTQ files, one url per flowcell.
output_vdj_directory Array[String] A list of google bucket urls containing vdj results, one url per sample.
metrics_summaries File A excel spreadsheet containing QCs for each sample.
output_web_summary Array[File] A list of htmls visualizing QCs for each sample (cellranger count output).
count_matrix String gs url for a template count_matrix.csv to run cumulus.

Build Cell Ranger References

We provide routines wrapping Cell Ranger tools to build references for sc/snRNA-seq, scATAC-seq and single-cell immune profiling data.

Build references for sc/snRNA-seq

We provide a wrapper of cellranger mkref to build sc/snRNA-seq references. Please follow the instructions below.

1. Import cellranger_create_reference

Import cellranger_create_reference workflow to your workspace.

See the Terra documentation for adding a workflow. The cellranger_workflow workflow is under Broad Methods Repository with name “cumulus/cellranger_create_reference”.

Moreover, in the workflow page, click the Export to Workspace... button, and select the workspace to which you want to export cellranger_create_reference workflow in the drop-down menu.

2. Upload requred data to Google Bucket
Required data may include input sample sheet, genome FASTA files and gene annotation GTF files.
3. Input sample sheet

If multiple species are specified, a sample sheet in CSV format is required. We describe the sample sheet format below, with required columns highlighted in bold:

Column Description
Genome Genome name
Fasta Location to the genome assembly in FASTA/FASTA.gz format
Genes Location to the gene annotation file in GTF/GTF.gz format
Attributes Optional, A list of key:value pairs separated by ;. If set, cellranger mkgtf will be called to filter the user-provided GTF file. See 10x filter with mkgtf for more details

Please note that the columns in the CSV can be in any order, but that the column names must match the recognized headings.

See below for an example for building Example:

Genome,Fasta,Genes,Attributes
GRCh38,gs://fc-e0000000-0000-0000-0000-000000000000/GRCh38.fa.gz,gs://fc-e0000000-0000-0000-0000-000000000000/GRCh38.gtf.gz,gene_biotype:protein_coding;gene_biotype:lincRNA;gene_biotype:antisense
mm10,gs://fc-e0000000-0000-0000-0000-000000000000/mm10.fa.gz,gs://fc-e0000000-0000-0000-0000-000000000000/mm10.gtf.gz

If multiple species are specified, the reference will built under Genome names concatenated by ‘_and_’s. In the above example, the reference is stored under ‘GRCh38_and_mm10’.

4. Workflow input

Required inputs are highlighted in bold. Note that input_sample_sheet and input_fasta, input_gtf , genome and attributes are mutually exclusive.

Name Description Example Default
input_sample_sheet A sample sheet in CSV format allows users to specify more than 1 genomes to build references (e.g. human and mouse). If a sample sheet is provided, input_fasta, input_gtf, and attributes will be ignored. “gs://fc-e0000000-0000-0000-0000-000000000000/input_sample_sheet.csv”  
input_fasta Input genome reference in either FASTA or FASTA.gz format “gs://fc-e0000000-0000-0000-0000-000000000000/Homo_sapiens.GRCh38.dna.toplevel.fa.gz”  
input_gtf Input gene annotation file in either GTF or GTF.gz format “gs://fc-e0000000-0000-0000-0000-000000000000/Homo_sapiens.GRCh38.94.chr_patch_hapl_scaff.gtf.gz”  
genome Genome reference name. New reference will be stored in a folder named genome refdata-cellranger-vdj-GRCh38-alts-ensembl-3.1.0  
output_directory Output directory “gs://fc-e0000000-0000-0000-0000-000000000000/cellranger_reference”  
attributes A list of key:value pairs separated by ;. If this option is not None, cellranger mkgtf will be called to filter the user-provided GTF file. See 10x filter with mkgtf for more details “gene_biotype:protein_coding;gene_biotype:lincRNA;gene_biotype:antisense”  
pre_mrna If we want to build pre-mRNA references, in which we use full length transcripts as exons in the annotation file. We follow 10x build Cell Ranger compatible pre-mRNA Reference Package to build pre-mRNA references true false
ref_version reference version string Ensembl v94  
cellranger_version cellranger version, could be 4.0.0, 3.1.0, 3.0.2, or 2.2.0 “4.0.0” “4.0.0”
docker_registry

Docker registry to use for cellranger_workflow. Options:

  • “quay.io/cumulus” for images on Red Hat registry;
  • “cumulusprod” for backup images on Docker Hub.
“quay.io/cumulus” “quay.io/cumulus”
zones Google cloud zones “us-central1-a us-west1-a” “us-central1-a us-central1-b us-central1-c us-central1-f us-east1-b us-east1-c us-east1-d us-west1-a us-west1-b us-west1-c”
num_cpu Number of cpus to request for one node for building indices 1 1
memory Memory size in GB 32 32
disk_space Optional disk space in GB 100 100
preemptible Number of preemptible tries 2 2
5. Workflow output
Name Type Description
output_reference File Gzipped reference folder with name genome.tar.gz. We will also store a copy of the gzipped tarball under output_directory specified in the input.

Build references for scATAC-seq

We provide a wrapper of cellranger-atac mkref to build scATAC-seq references. Please follow the instructions below.

1. Import cellranger_atac_create_reference

Import cellranger_atac_create_reference workflow to your workspace.

See the Terra documentation for adding a workflow. The cellranger_workflow workflow is under Broad Methods Repository with name “cumulus/cellranger_atac_create_reference”.

Moreover, in the workflow page, click the Export to Workspace... button, and select the workspace to which you want to export cellranger_atac_create_reference workflow in the drop-down menu.

2. Upload required data to Google Bucket
Required data include config JSON file, genome FASTA file, gene annotation file (GTF or GFF3 format) and motif input file (JASPAR format).
3. Workflow input

Required inputs are highlighted in bold.

Name Description Example Default
genome Genome reference name. New reference will be stored in a folder named genome refdata-cellranger-atac-mm10-1.1.0  
config_json Configuration file defined in 10x genomics configuration file. Note that links to files in the JSON must be Google bucket URLs “gs://fc-e0000000-0000-0000-0000-000000000000/config.json”  
output_directory Output directory “gs://fc-e0000000-0000-0000-0000-000000000000/cellranger_atac_reference”  
cellranger_atac_version cellranger-atac version, could be: 1.2.0, 1.1.0 “1.2.0” “1.2.0”
docker_registry

Docker registry to use for cellranger_workflow. Options:

  • “quay.io/cumulus” for images on Red Hat registry;
  • “cumulusprod” for backup images on Docker Hub.
“quay.io/cumulus” “quay.io/cumulus”
zones Google cloud zones “us-central1-a us-west1-a” “us-central1-a us-central1-b us-central1-c us-central1-f us-east1-b us-east1-c us-east1-d us-west1-a us-west1-b us-west1-c”
memory Memory size string for cellranger-atac mkref “32G” “32G”
disk_space Optional disk space in GB 100 100
preemptible Number of preemptible tries 2 2
4. Workflow output
Name Type Description
output_reference File Gzipped reference folder with name genome.tar.gz. We will also store a copy of the gzipped tarball under output_directory specified in the input.

Build references for single-cell immune profiling data

We provide a wrapper of cellranger mkvdjref to build single-cell immune profiling references. Please follow the instructions below.

1. Import cellranger_vdj_create_reference

Import cellranger_vdj_create_reference workflow to your workspace.

See the Terra documentation for adding a workflow. The cellranger_workflow workflow is under Broad Methods Repository with name “cumulus/cellranger_vdj_create_reference”.

Moreover, in the workflow page, click the Export to Workspace... button, and select the workspace to which you want to export cellranger_vdj_create_reference workflow in the drop-down menu.

2. Upload requred data to Google Bucket
Required data include genome FASTA file and gene annotation file (GTF format).
3. Workflow input

Required inputs are highlighted in bold.

Name Description Example Default
input_fasta Input genome reference in either FASTA or FASTA.gz format “gs://fc-e0000000-0000-0000-0000-000000000000/Homo_sapiens.GRCh38.dna.toplevel.fa.gz”  
input_gtf Input gene annotation file in either GTF or GTF.gz format “gs://fc-e0000000-0000-0000-0000-000000000000/Homo_sapiens.GRCh38.94.chr_patch_hapl_scaff.gtf.gz”  
genome Genome reference name. New reference will be stored in a folder named genome refdata-cellranger-vdj-GRCh38-alts-ensembl-3.1.0  
output_directory Output directory “gs://fc-e0000000-0000-0000-0000-000000000000/cellranger_vdj_reference”  
ref_version reference version string Ensembl v94  
cellranger_version cellranger version, could be 4.0.0, 3.1.0, 3.0.2, or 2.2.0 “4.0.0” “4.0.0”
docker_registry

Docker registry to use for cellranger_workflow. Options:

  • “quay.io/cumulus” for images on Red Hat registry;
  • “cumulusprod” for backup images on Docker Hub.
“quay.io/cumulus” “quay.io/cumulus”
zones Google cloud zones “us-central1-a us-west1-a” “us-central1-a us-central1-b us-central1-c us-central1-f us-east1-b us-east1-c us-east1-d us-west1-a us-west1-b us-west1-c”
memory Memory size string for cellranger-atac mkref “32G” “32G”
disk_space Optional disk space in GB 100 100
preemptible Number of preemptible tries 2 2
4. Workflow output
Name Type Description
output_reference File Gzipped reference folder with name genome.tar.gz. We will also store a copy of the gzipped tarball under output_directory specified in the input.

Run Space Ranger tools using spaceranger_workflow

spaceranger_workflow wraps Space Ranger to process spatial transcriptomics data.

A general step-by-step instruction

This section mainly considers jobs starting from BCL files. If your job starts with FASTQ files, and only need to run spaceranger count part, please refer to this subsection.

1. Import spaceranger_workflow

Import spaceranger_workflow workflow to your workspace.

See the Terra documentation for adding a workflow. The spaceranger_workflow workflow is under Broad Methods Repository with name “cumulus/spaceranger_workflow”.

Moreover, in the workflow page, click the Export to Workspace... button, and select the workspace to which you want to export spaceranger_workflow workflow in the drop-down menu.

2. Upload sequencing and image data to Google bucket

Copy your sequencing output to your workspace bucket using gsutil (you already have it if you’ve installed Google cloud SDK) in your unix terminal.

You can obtain your bucket URL in the dashboard tab of your Terra workspace under the information panel.

_images/google_bucket_link.png

Use gsutil cp [OPTION]... src_url dst_url to copy data to your workspace bucket. For example, the following command copies the directory at /foo/bar/nextseq/Data/VK18WBC6Z4 to a Google bucket:

gsutil -m cp -r /foo/bar/nextseq/Data/VK18WBC6Z4 gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4

-m means copy in parallel, -r means copy the directory recursively, and gs://fc-e0000000-0000-0000-0000-000000000000 should be replaced by your own workspace Google bucket URL.

Similarly, copy all images for spatial data to the same google bucket.

Note

If input is a folder of BCL files, users do not need to upload the whole folder to the Google bucket. Instead, they only need to upload the following files:

RunInfo.xml
RTAComplete.txt
runParameters.xml
Data/Intensities/s.locs
Data/Intensities/BaseCalls

If data are generated using MiSeq or NextSeq, the location files are inside lane subfloders L001 under Data/Intensities/. In addition, if users’ data only come from a subset of lanes (e.g. L001 and L002), users only need to upload lane subfolders from the subset (e.g. Data/Intensities/BaseCalls/L001, Data/Intensities/BaseCalls/L002 and Data/Intensities/L001, Data/Intensities/L002 if sequencer is MiSeq or NextSeq).

Alternatively, users can submit jobs through command line interface (CLI) using altocumulus, which will smartly upload BCL folders according to the above rules.

Note

Broad users need to be on an UGER node (not a login node) in order to use the -m flag

Request an UGER node:

reuse UGER
qrsh -q interactive -l h_vmem=4g -pe smp 8 -binding linear:8 -P regevlab

The above command requests an interactive node with 4G memory per thread and 8 threads. Feel free to change the memory, thread, and project parameters.

Once you’re connected to an UGER node, you can make gsutil available by running:

reuse Google-Cloud-SDK
3. Prepare a sample sheet

3.1 Sample sheet format:

Please note that the columns in the CSV can be in any order, but that the column names must match the recognized headings.

The sample sheet describes how to demultiplex flowcells and generate channel-specific count matrices. Note that Sample, Lane, and Index columns are defined exactly the same as in 10x’s simple CSV layout file.

A brief description of the sample sheet format is listed below (required column headers are shown in bold).

Column Description
Sample Contains sample names. Each 10x channel should have a unique sample name.
Reference
Provides the reference genome used by Space Ranger for each 10x channel.
The elements in the reference column can be either Google bucket URLs to reference tarballs or keywords such as GRCh38-2020-A.
A full list of available keywords is included in each of the following data type sections (e.g. sc/snRNA-seq) below.
Flowcell
Indicates the Google bucket URLs of uploaded BCL folders.
If starts with FASTQ files, this should be Google bucket URLs of uploaded FASTQ folders.
The FASTQ folders should contain one subfolder for each sample in the flowcell with the sample name as the subfolder name.
Each subfolder contains FASTQ files for that sample.
Lane
Tells which lanes the sample was pooled into.
Can be either single lane (e.g. 8) or a range (e.g. 7-8) or all (e.g. *).
Index Sample index (e.g. SI-GA-A12).
Image Google bucket url for a brightfield tissue H&E image in .jpg or .tiff format. This column is mutually exclusive with DarkImage and ColorizedImage columns.
DarkImage Google bucket urls for Multi-channel, dark-background fluorescence image as either a single, multi-layer .tiff file, multiple .tiff or .jpg files, or a pre-combined color .tiff or .jpg file. If multiple files are provided, please separate them by ‘;’. This column is mutually exclusive with Image and ColorizedImage columns.
ColorizedImage Google bucket url for a color composite of one or more fluorescence image channels saved as a single-page, single-file color .tiff or .jpg. This column is mutually exclusive with Image and DarkImage columns.
Slide Visium slide serial number. If both Slide and Area are empty, the –unknown-slide option would be set.
Area Visium capture area identifier. Options for Visium are A1, B1, C1, D1. If both Slide and Area are empty, the –unknown-slide option would be set.
SlideFile Slide layout file indicating capture spot and fiducial spot positions. Only required if internet access is not available.
ReorientImages Use with automatic image alignment to specify that images may not be in canonical orientation with the hourglass in the top left corner of the image. The automatic fiducial alignment will attempt to align any rotation or mirroring of the image.
LoupeAlignment Alignment file produced by the manual Loupe alignment step. Image column must be supplied in this case.
TargetPanel Google bucket url for a target panel CSV for targeted gene expression analysis.

The sample sheet supports sequencing the same 10x channels across multiple flowcells. If a sample is sequenced across multiple flowcells, simply list it in multiple rows, with one flowcell per row. In the following example, we have 2 samples sequenced in two flowcells.

Example:

Sample,Reference,Flowcell,Lane,Index,Image,Slide,Area
sample_1,GRCh38-2020-A,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,1-2,SI-GA-A8,gs://image/image1.tif,V19J25-123,A1
sample_2,GRCh38-2020-A,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,3-4,SI-GA-B8,gs://image/image2.tif,V19J25-123,B1
sample_1,GRCh38-2020-A,gs://fc-e0000000-0000-0000-0000-000000000000/VK10WBC9Z2,1-2,SI-GA-A8,gs://image/image1.tif,V19J25-123,A1
sample_2,GRCh38-2020-A,gs://fc-e0000000-0000-0000-0000-000000000000/VK10WBC9Z2,3-4,SI-GA-B8,gs://image/image2.tif,V19J25-123,B1

3.2 Upload your sample sheet to the workspace bucket:

Example:

gsutil cp /foo/bar/projects/sample_sheet.csv gs://fc-e0000000-0000-0000-0000-000000000000/
4. Launch analysis

In your workspace, open spaceranger_workflow in WORKFLOWS tab. Select the desired snapshot version (e.g. latest). Select Run workflow with inputs defined by file paths as below

_images/single_workflow.png

and click SAVE button. Select Use call caching and click INPUTS. Then fill in appropriate values in the Attribute column. Alternative, you can upload a JSON file to configure input by clicking Drag or click to upload json.

Once INPUTS are appropriated filled, click RUN ANALYSIS and then click LAUNCH.

5. Notice: run spaceranger mkfastq if you are non Broad Institute users

Non Broad Institute users that wish to run spaceranger mkfastq must create a custom docker image that contains bcl2fastq.

See bcl2fastq instructions.
6. Run spaceranger count only

Sometimes, users might want to perform demultiplexing locally and only run the count part on the cloud. This section describes how to only run the count part via spaceranger_workflow.

  1. Copy your FASTQ files to the workspace using gsutil in your unix terminal.

    You should upload folders of FASTQ files. The uploaded folder (for one flowcell) should contain one subfolder for each sample belong to the this flowcell. In addition, the subfolder name and the sample name in your sample sheet MUST be the same. Each subfolder contains FASTQ files for that sample. Please note that if your FASTQ file are downloaded from the Sequence Read Archive (SRA) from NCBI, you must rename your FASTQs to follow the bcl2fastq file naming conventions.

    Example:

    gsutil -m cp -r /foo/bar/fastq_path/K18WBC6Z4 gs://fc-e0000000-0000-0000-0000-000000000000/K18WBC6Z4_fastq
    
  2. Create a sample sheet following the similar structure as above, except the following differences:

    • Flowcell column should list Google bucket URLs of the FASTQ folders for flowcells.
    • Lane and Index columns are NOT required in this case.

    Example:

    Sample,Reference,Flowcell,Image,Slide,Area
    sample_1,GRCh38-2020-A,gs://fc-e0000000-0000-0000-0000-000000000000/K18WBC6Z4_fastq,gs://image/image1.tif,V19J25-123,A1
    
  3. Set optional input run_mkfastq to false.


Visium spatial transcriptomics data

To process spatial transcriptomics data, follow the specific instructions below.

Sample sheet
  1. Reference column.

    Pre-built scRNA-seq references are summarized below.

    Keyword Description
    GRCh38-2020-A Human GRCh38 (GENCODE v32/Ensembl 98)
    mm10-2020-A Mouse mm10 (GENCODE vM23/Ensembl 98)
    GRCh38_and_mm10-2020-A Human GRCh38 (GENCODE v32/Ensembl 98) and mouse mm10 (GENCODE vM23/Ensembl 98)
    GRCh38_v3.0.0 Human GRCh38, spaceranger reference 3.0.0, Ensembl v93 gene annotation
    hg19_v3.0.0 Human hg19, cellranger reference 3.0.0, Ensembl v87 gene annotation
    mm10_v3.0.0 Mouse mm10, cellranger reference 3.0.0, Ensembl v93 gene annotation
    GRCh38_and_mm10_v3.1.0 Human (GRCh38) and mouse (mm10), cellranger references 3.1.0, Ensembl v93 gene annotations for both human and mouse
    hg19_and_mm10_v3.0.0 Human (hg19) and mouse (mm10), cellranger reference 3.0.0, Ensembl v93 gene annotations for both human and mouse
    GRCh38_v1.2.0 or GRCh38 Human GRCh38, cellranger reference 1.2.0, Ensembl v84 gene annotation
    hg19_v1.2.0 or hg19 Human hg19, cellranger reference 1.2.0, Ensembl v82 gene annotation
    mm10_v1.2.0 or mm10 Mouse mm10, cellranger reference 1.2.0, Ensembl v84 gene annotation
    GRCh38_and_mm10_v1.2.0 or GRCh38_and_mm10 Human and mouse, built from GRCh38 and mm10 cellranger references, Ensembl v84 gene annotations are used

    Pre-built snRNA-seq references are summarized below.

    Keyword Description
    GRCh38_premrna_v3.0.0 Human, introns included, built from GRCh38 cellranger reference 3.0.0, Ensembl v93 gene annotation, treating annotated transcripts as exons
    GRCh38_premrna_v1.2.0 or GRCh38_premrna Human, introns included, built from GRCh38 cellranger reference 1.2.0, Ensembl v84 gene annotation, treating annotated transcripts as exons
    mm10_premrna_v1.2.0 or mm10_premrna Mouse, introns included, built from mm10 cellranger reference 1.2.0, Ensembl v84 gene annotation, treating annotated transcripts as exons
    GRCh38_premrna_and_mm10_premrna_v1.2.0 or GRCh38_premrna_and_mm10_premrna Human and mouse, introns included, built from GRCh38_premrna_v1.2.0 and mm10_premrna_v1.2.0
Workflow input

For spatial data, spaceranger_workflow takes Illumina outputs and related images as input and runs spaceranger mkfastq and spaceranger count. Revalant workflow inputs are described below, with required inputs highlighted in bold.

Name Description Example Default
input_csv_file Sample Sheet (contains Sample, Reference, Flowcell, Lane, Index as required and Image, DarkImage, ColorizedImage, Slide, Area, SlideFile, ReorientImages, LoupeAlignment, TargetPanel as optional) “gs://fc-e0000000-0000-0000-0000-000000000000/sample_sheet.csv”  
output_directory Output directory “gs://fc-e0000000-0000-0000-0000-000000000000/spaceranger_output” Results are written under directory output_directory and will overwrite any existing files at this location.
run_mkfastq If you want to run spaceranger mkfastq true true
run_count If you want to run spaceranger count true true
delete_input_bcl_directory If delete BCL directories after demux. If false, you should delete this folder yourself so as to not incur storage charges false false
mkfastq_barcode_mismatches Number of mismatches allowed in matching barcode indices (bcl2fastq2 default is 1) 0  
no_bam Turn this option on to disable BAM file generation. false false
secondary Perform Space Ranger secondary analysis (dimensionality reduction, clustering, etc.) false false
spaceranger_version spaceranger version, could be 1.2.1 “1.2.1” “1.2.1”
config_version config docker version used for processing sample sheets, could be 0.2, 0.1 “0.2” “0.2”
docker_registry

Docker registry to use for spaceranger_workflow. Options:

  • “quay.io/cumulus” for images on Red Hat registry;
  • “cumulusprod” for backup images on Docker Hub.
“quay.io/cumulus” “quay.io/cumulus”
spaceranger_mkfastq_docker_registry Docker registry to use for spaceranger mkfastq. Default is the registry to which only Broad users have access. See bcl2fastq for making your own registry. “gcr.io/broad-cumulus” “gcr.io/broad-cumulus”
zones Google cloud zones “us-central1-a us-west1-a” “us-central1-a us-central1-b us-central1-c us-central1-f us-east1-b us-east1-c us-east1-d us-west1-a us-west1-b us-west1-c”
num_cpu Number of cpus to request for one node for spaceranger mkfastq and spaceranger count 32 32
memory Memory size string for spaceranger mkfastq and spaceranger count “120G” “120G”
mkfastq_disk_space Optional disk space in GB for mkfastq 1500 1500
count_disk_space Disk space in GB needed for spaceranger count 500 500
preemptible Number of preemptible tries 2 2
Workflow output

See the table below for important sc/snRNA-seq outputs.

Name Type Description
output_fastqs_directory Array[String] A list of google bucket urls containing FASTQ files, one url per flowcell.
output_count_directory Array[String] A list of google bucket urls containing count matrices, one url per sample.
metrics_summaries File A excel spreadsheet containing QCs for each sample.
output_web_summary Array[File] A list of htmls visualizing QCs for each sample (spaceranger count output).

Build Space Ranger References

Reference built by Cell Ranger for sc/snRNA-seq should be compatible with Space Ranger. For more details on building references uing Cell Ranger, please refer to here.

Run STARsolo to generate gene-count matrices from FASTQ files

This star_solo workflow generates gene-count matrices from FASTQ data using STARsolo.

Prepare input data and import workflow

1. Run cellranger_workflow to generate FASTQ data

You can skip this step if your data are already in FASTQ format.

Otherwise, for 10X data, you need to first run cellranger_workflow to generate FASTQ files from BCL raw data for each sample. Please follow cellranger_workflow manual.

Notice that you should set run_mkfastq to true to get FASTQ output. You can also set run_count to false to skip Cell Ranger count step.

For Non-Broad users, you’ll need to build your own docker for bcl2fastq step. Instructions are here.

2. Import star_solo

Import star_solo workflow to your workspace.

See the Terra documentation for adding a workflow. The star_solo workflow is under Broad Methods Repository with name “cumulus/star_solo”.

Moreover, in the workflow page, click the Export to Workspace... button, and select the workspace to which you want to export star_solo workflow in the drop-down menu.

3. Prepare a sample sheet

3.1 Sample sheet format:

The sample sheet for star_solo workflow should be in TSV format, i.e. columns are separated by tabs (NOT commas). Please note that the columns in the TSV can be in any order, but that the column names must match the recognized headings.

The sample sheet describes how to identify flowcells and generate sample/channel-specific count matrices.

A brief description of the sample sheet format is listed below (required column headers are shown in bold).

Column Description
Sample Contains sample names. Each sample or 10X channel should have a unique sample name.
Flowcells Indicates the Google bucket URLs of folder(s) holding FASTQ files of this sample.

For 10X data, the sample sheet supports sequencing the same 10X channel across multiple flowcells. If a sample is sequenced across multiple flowcells, simply list all of its flowcells in a comma-seperated way. In the following example, we have 2 samples sequenced in two flowcells.

Example:

Sample  Flowcells
sample_1        gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4/sample_1_fastqs,gs://fc-e0000000-0000-0000-0000-000000000000/VK10WBC9Z2/sample_1_fastqs
sample_2        gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4/sample_2_fastqs

Alternatively, if you want to specify Read 1 and 2 FASTQ files yourself, you should prepare the sample sheet of the following format:

Sample  R1      R2
sample_1        gs://your-bucket/sample_1_L001_R1.fastq.gz,gs://your-bucket/sample_1_L002_R1.fastq.gz   gs://your-bucket/sample_1_L001_R2.fastq.gz,gs://your-bucket/sample_1_L002_R2.fastq.gz
sample_2        gs://your-bucket/sample_2_L001_R1.fastq.gz      gs://your-bucket/sample_2_L001_R2.fastq.gz

where FASTQ files in R1 and R2 should be in one-to-one correspondence if the sample has multiple R1 FASTQ files.

3.2 Upload your sample sheet to the workspace bucket:

Use gsutil (you already have it if you’ve installed Google cloud SDK) in your unix terminal to upload your sample sheet to workspace bucket.

Example:

gsutil cp /foo/bar/projects/sample_sheet.tsv gs://fc-e0000000-0000-0000-0000-000000000000/
4. Launch analysis

In your workspace, open star_solo in WORKFLOWS tab. Select the desired snapshot version (e.g. latest). Select Process single workflow from files as below

_images/single_workflow.png

and click SAVE button. Select Use call caching and click INPUTS. Then fill in appropriate values in the Attribute column. Alternative, you can upload a JSON file to configure input by clicking Drag or click to upload json.

Once INPUTS are appropriated filled, click RUN ANALYSIS and then click LAUNCH.


Workflow inputs

Below are inputs for count workflow. Notice that required inputs are in bold.

Name Description Example Default
input_tsv_file Input TSV sample sheet describing metadata of each sample. “gs://fc-e0000000-0000-0000-0000-000000000000/sample_sheet.tsv”  
genome

Genome reference. It can be either of the following two formats:

  • String. Pre-built genome reference. Currently support: GRCh38, mm10.
  • Google bucket URL of a custom reference, must be a .tar.gz file.
“GRCh38”,
or “gs://user-bucket/starsolo.tar.gz”
 
chemistry Chemistry name. Available options: “tenX_v3” (for 10X V3 chemistry), “tenX_v2” (for 10X V2 chemistry), “DropSeq”, and “SeqWell”. “tenX_v3”  
output_directory GS URL of output directory. “gs://fc-e0000000-0000-0000-0000-000000000000/count_result”  
docker_registry

Docker registry to use:

  • “quay.io/cumulus” for images on Red Hat registry;
  • “cumulusprod” for backup images on Docker Hub.
“quay.io/cumulus” “quay.io/cumulus”
zones Google cloud zones to consider for execution. “us-east1-d us-west1-a us-west1-b” “us-central1-a us-central1-b us-central1-c us-central1-f us-east1-b us-east1-c us-east1-d us-west1-a us-west1-b us-west1-c”
num_cpu Number of CPUs to request for count per sample. 32 32
disk_space Disk space in GB needed for count per sample. 500 500
memory Memory size in GB needed for count per sample. 120 120
preemptible Number of maximum preemptible tries allowed. 2 2
star_version STAR version to use. Currently only support 2.7.6a. “2.7.6a” “2.7.6a”
config_version Version of docker image to run configuration on the sample sheet. Currently only has version “0.1”. “0.1” “0.1”

Workflow outputs

See the table below for star_solo workflow outputs.

Name Type Description
output_folder String Google Bucket URL of output directory. Within it, each folder is for one sample in the input sample sheet.

Demultiplex genetic-pooling/cell-hashing/nucleus-hashing sc/snRNA-Seq data

This demultiplexing workflow generates gene-count matrices from cell-hashing/nucleus-hashing/genetic-pooling data by demultiplexing.

In the workflow, demuxEM is used for analyzing cell-hashing/nucleus-hashing data, while souporcell and demuxlet are for genetic-pooling data.

Prepare input data and import workflow

1. Run cellranger_workflow

To demultiplex, you’ll need raw gene count and hashtag matrices for cell-hashing/nucleus-hashing data, or raw gene count matrices and genome BAM files for genetic-pooling data. You can generate these data by running the cellranger_workflow.

Please refer to the cellranger_workflow tutorial for details.

When finished, you should be able to find the raw gene count matrix (e.g. raw_gene_bc_matrices_h5.h5), hashtag matrix (e.g. sample_1_ADT.csv) / genome BAM file (e.g. possorted_genome_bam.bam) for each sample.

2. Import demultiplexing

Import demultiplexing workflow to your workspace.

See the Terra documentation for adding a workflow. The demultiplexing workflow is under Broad Methods Repository with name “cumulus/demultiplexing”.

Moreover, in the workflow page, click the Export to Workspace... button, and select the workspace to which you want to export demultiplexing workflow in the drop-down menu.

3. Prepare a sample sheet

3.1 Sample sheet format:

Create a sample sheet, sample_sheet_demux.csv, which describes the metadata for each pair of RNA and hashtag data. A brief description of the sample sheet format is listed below (required column headers are shown in bold).

Column Description
OUTNAME Output name for one pair of RNA and hashtag data. Must be unique per pair.
RNA Google bucket url to the raw gene count matrix generated in Step 1.
TagFile/ADT Google bucket url to the hashtag file generated in Step 1. The column name can be either TagFile or ADT, where ADT is to be backward compatible with sample sheets working with cumulus/cumulus_hashing_cite_seq workflow.
TYPE Assay type, which can be cell-hashing, nucleus-hashing, or genetic-pooling.
Genotype

Google bucket url to the reference genotypes in vcf.gz format. This column is not required in the following cases:

  • When TYPE is cell-hashing or nucleus-hashing;
  • When TYPE is genetic-pooling, demultiplexing_algorithm input is souporcell, and user wish to run in de novo mode without reference genotypes, and don’t need to rename cluster names by information from a known genotype vcf file.

Example:

OUTNAME,RNA,TagFile,TYPE,Genotype
sample_1,gs://exp/data_1/raw_gene_bc_matrices_h5.h5,gs://exp/data_1/sample_1_ADT.csv,cell-hashing
sample_2,gs://exp/data_2/raw_gene_bc_matrices_h5.h5,gs://exp/data_2/sample_2_ADT.csv,nucleus-hashing
sample_3,gs://exp/data_3/raw_gene_bc_matrices_h5.h5,gs://exp/data_3/possorted_genome_bam.bam,genetic-pooling
sample_4,gs://exp/data_4/raw_gene_bc_matrices_h5.h5,gs://exp/data_4/possorted_genome_bam.bam,genetic-pooling,gs://exp/variants/ref_genotypes.vcf.gz

3.2 Upload your sample sheet to the workspace bucket:

Use gsutil (you already have it if you’ve installed Google Cloud SDK) in your unix terminal to upload your sample sheet to workspace bucket.

Example:

gsutil cp /foo/bar/projects/sample_sheet_demux.csv gs://fc-e0000000-0000-0000-0000-000000000000/

Workflow inputs

Below are inputs for demultiplexing workflow. We’ll first introduce global inputs, and then inputs for each of the demultiplexing tools. Notice that required inputs are in bold.

global inputs
Name Description Example Default
input_sample_sheet Input CSV file describing metadata of RNA and hashtag data pairing. “gs://fc-e0000000-0000-0000-0000-000000000000/sample_sheet_demux.csv”  
output_directory This is the output directory (gs url + path) for all results. There will be one folder per RNA-hashtag data pair under this directory. “gs://fc-e0000000-0000-0000-0000-000000000000/demux_output”  
genome Reference genome name. You should choose one from this genome reference list. “GRCh38”  
demultiplexing_algorithm

demultiplexing algorithm to use for genetic-pooling data. Options:

  • “souporcell”: Use souporcell, a reference-genotypes-free algorithm for demultiplexing droplet scRNA-Seq data.
  • “demuxlet”: Use demuxlet, a canonical algorithm for demultiplexing droplet scRNA-Seq data.
“souporcell” “souporcell”
min_num_genes Only demultiplex cells/nuclei with at least <min_num_genes> expressed genes 100 100
docker_registry

Docker registry to use. Notice that docker image for Bustools is seperate.

  • “quay.io/cumulus” for images on Red Hat registry;
  • “cumulusprod” for backup images on Docker Hub.
“quay.io/cumulus” “quay.io/cumulus”
config_version Version of config docker image to use. This docker is used for parsing the input sample sheet for downstream execution. Available options: 0.2, 0.1. “0.2” “0.2”
zones Google cloud zones to consider for execution. “us-east1-d us-west1-a us-west1-b” “us-central1-a us-central1-b us-central1-c us-central1-f us-east1-b us-east1-c us-east1-d us-west1-a us-west1-b us-west1-c”
preemptible Number of maximum preemptible tries allowed. 2 2
demuxEM inputs
Name Description Example Default
demuxEM_alpha_on_samples demuxEM parameter. The Dirichlet prior concentration parameter (alpha) on samples. An alpha value < 1.0 will make the prior sparse. 0.0 0.0
demuxEM_min_num_umis demuxEM parameter. Only demultiplex cells/nuclei with at least <demuxEM_min_num_umis> of UMIs. 100 100
demuxEM_min_signal_hashtag demuxEM parameter. Any cell/nucleus with less than <demuxEM_min_signal_hashtag> hashtags from the signal will be marked as unknown. 10.0 10.0
demuxEM_random_state demuxEM parameter. The random seed used in the KMeans algorithm to separate empty ADT droplets from others. 0 0
demuxEM_generate_diagnostic_plots demuxEM parameter. If generate a series of diagnostic plots, including the background/signal between HTO counts, estimated background probabilities, HTO distributions of cells and non-cells, etc. true true
demuxEM_generate_gender_plot demuxEM parameter. If generate violin plots using gender-specific genes (e.g. Xist). <demuxEM_generate_gender_plot> is a comma-separated list of gene names “XIST”  
demuxEM_version demuxEM version to use. Currently only support “0.1.5”. “0.1.5” “0.1.5”
demuxEM_num_cpu demuxEM parameter. Number of CPUs to request for demuxEM per pair. 8 8
demuxEM_memory demuxEM parameter. Memory size (integer) in GB needed for demuxEM per pair. 10 10
demuxEM_disk_space demuxEM parameter. Disk space (integer) in GB needed for demuxEM per pair. 20 20
souporcell inputs
Name Description Example Default
souporcell_version souporcell version to use. Available versions: “2020.07”, “2020.03”. “2020.07” “2020.07”
souporcell_de_novo_mode
souporcell parameter.
If true, run souporcell in de novo mode without reference genotypes; and if a reference genotype vcf file is provided in the sample sheet, use it only for matching the cluster labels computed by souporcell.
If false, run souporcell with --known_genotypes option using the reference genotype vcf file specified in sample sheet, and souporcell_rename_donors is required in this case.
true true
souporcell_num_clusters
souporcell parameter. Number of expected clusters when doing clustering.
This needs to be set when running souporcell.
8  
souporcell_rename_donors
souporcell parameter. A comma-separated list of donor names for renaming clusters achieved by souporcell.
By default, the resulting donors are Donor1, Donor2, …
“CB1,CB2,CB3,CB4”  
souporcell_num_cpu souporcell parameter. Number of CPUs to request for souporcell per pair. 32 32
souporcell_memory souporcell parameter. Memory size (integer) in GB needed for souporcell per pair. 120 120
souporcell_disk_space souporcell parameter. Disk space (integer) in GB needed for souporcell per pair. 500 500
demuxlet inputs
Name Description Example Default
demuxlet_version demuxlet version to use. Currently only support “0.1b”. “0.1b” “0.1b”
demuxlet_memory demuxlet parameter. Memory size (integer) in GB needed for demuxlet per pair. 10 10
demuxlet_disk_space
demuxlet parameter. Disk space size (integer) in GB needed for demuxlet per pair.
Notice that the overall disk space for demuxlet is this disk space plus the size of provided reference genotypes file in the sample sheet.
2 2

Workflow outputs

See the table below for demultiplexing workflow outputs.

Name Type Description
output_folders Array[String] A list of Google Bucket URLs of the output folders. Each folder is associated with one RNA-hashtag pair in the given sample sheet.
output_zarr_files Array[File] A list of demultiplexed RNA count matrices in zarr format. Each zarr file is associated with one RNA-hashtag pair in the given sample sheet. Please refere to section load demultiplexing results into Python and R for its structure.

In the output subfolder of each cell-hashing/nuclei-hashing RNA-hashtag data pair, you can find the following files:

Name Description
output_name_demux.zarr.zip Demultiplexed RNA count matrix in zarr format. Please refer to section load demultiplexing results into Python and R for its structure.
output_name.out.demuxEM.zarr.zip
RNA expression matrix with demultiplexed sample identities in zarr format.
To load this file into Python, you need to first install Pegasusio on your local machine. Then use import pegasusio as io; data = io.read_input("output_name.out.demuxEM.zarr.zip") in Python environment.
It contains 2 UnimodalData objects: one with key name suffix -hashing is the hashtag count matrix, the other one with key name suffix -rna is the demultiplexed RNA count matrix.
To load the hashtag count matrix, type hash_data = data.get_data('<genome>-hashing'), where <genome> is the genome name of the data. The count matrix is hash_data.X; cell barcode attributes are stored in hash_data.obs; sample names are in hash_data.var_names. Moreover, the estimated background probability regarding hashtags is in hash_data.uns['background_probs'].
To load the RNA matrix, type rna_data = data.get_data('<genome>-rna'), where <genome> is the genome name of the data. It only contains cells which have estimated sample assignments. The count matrix is rna_data.X. Cell barcode attributes are stored in rna_data.obs: rna_data.obs['demux_type'] stores the estimated droplet types (singlet/doublet/unknown) of cells; rna_data.obs['assignment'] stores the estimated hashtag(s) that each cell belongs to. Moreover, for cell-hashing/nucleus-hashing data, you can find estimated sample fractions (sample1, sample2, …, samplen, background) for each droplet in rna_data.obsm['raw_probs'].
output_name.ambient_hashtag.hist.png Optional output. A histogram plot depicting hashtag distributions of empty droplets and non-empty droplets.
output_name.background_probabilities.bar.png Optional output. A bar plot visualizing the estimated hashtag background probability distribution.
output_name.real_content.hist.png Optional output. A histogram plot depicting hashtag distributions of not-real-cells and real-cells as defined by total number of expressed genes in the RNA assay.
output_name.rna_demux.hist.png Optional output. A histogram plot depicting RNA UMI distribution for singlets, doublets and unknown cells.
output_name.gene_name.violin.png Optional outputs. Violin plots depicting gender-specific gene expression across samples. We can have multiple plots if a gene list is provided in demuxEM_generate_gender_plot field of cumulus_hashing_cite_seq inputs.

In the output subfolder of each genetic-pooling RNA-hashtag data pair generated by souporcell, you can find the following files:

Name Description
output_name_demux.zarr.zip Demultiplexed RNA count matrix in zarr format. Please refer to section load demultiplexing results into Python and R for its structure.
clusters.tsv Inferred droplet type and cluster assignment for each cell barcode.
cluster_genotypes.vcf Inferred genotypes for each cluster.
match_donors.log Log of matching donors step, with information of donor matching included.

In the output subfolder of each genetic-pooling RNA-hashtag data pair generated by demuxlet, you can find the following files:

Name Description
output_name_demux.zarr.zip Demultiplexed RNA count matrix in zarr format. Please refer to section load demultiplexing results into Python and R for its structure.
output_name.best Inferred droplet type and cluster assignment for each cell barcode.

Load demultiplexing results into Python and R

To load demultiplexed RNA count matrix into Python, you need to install Python package pegasusio first. Then follow the codes below:

import pegasusio as io
data = io.read_input('output_name_demux.zarr.zip')

Once you load the data object, you can find estimated droplet types (singlet/doublet/unknown) in data.obs['demux_type']. Notices that there are cell barcodes with no sample associated, and therefore have no droplet type.

You can also find estimated sample assignments in data.obs['assignment'].

For cell-hashing/nucleus-hashing data, if one sample name can correspond to multiple feature barcodes, each feature barcode is assigned to a unique sample name, and this deduplicated sample assignment results are in data.obs['assignment.dedup'].

To load the results into R, you need to install R package reticulate in addition to Python package pegasusio. Then follow the codes below:

library(reticulate)
ad <- import("pegasusio", convert = FALSE)
data <- ad$read_input("output_name_demux.zarr.zip")

Results are in data$obs['demux_type'], data$obs['assignment'], and similarly as above, for cell-hashing/nucleus-hashing data, you’ll find an additional field data$obs['assignment.dedup'] for deduplicated sample assignment in the case that one sample name can correspond to multiple feature barcodes.

Run Cumulus for sc/snRNA-Seq data analysis

Run Cumulus analysis

Prepare Input Data
Case One: Sample Sheet

Follow the steps below to run cumulus on Terra.

  1. Create a sample sheet, count_matrix.csv, which describes the metadata for each sample count matrix. The sample sheet should at least contain 2 columns — Sample and Location. Sample refers to sample names and Location refers to the location of the channel-specific count matrix in either of
  • 10x format with v2 chemistry. For example, gs://fc-e0000000-0000-0000-0000-000000000000/my_dir/sample_1/raw_gene_bc_matrices_h5.h5.
  • 10x format with v3 chemistry. For example, gs://fc-e0000000-0000-0000-0000-000000000000/my_dir/sample_1/raw_feature_bc_matrices.h5.
  • Drop-seq format. For example, gs://fc-e0000000-0000-0000-0000-000000000000/my_dir/sample_2/sample_2.umi.dge.txt.gz.
  • Matrix Market format (mtx). If the input is mtx format, location should point to a mtx file with a file suffix of either ‘.mtx’ or ‘.mtx.gz’. In addition, the associated barcode and gene tsv/txt files should be located in the same folder as the mtx file. For example, if we generate mtx file using BUStools, we set Location to gs://fc-e0000000-0000-0000-0000-000000000000/my_dir/mm10/cells_x_genes.mtx. We expect to see cells_x_genes.barcodes.txt and cellx_x_genes.genes.txt under folder gs://fc-e0000000-0000-0000-0000-000000000000/my_dir/mm10/. We support loading mtx files in HCA DCP, 10x Genomics V2/V3, SCUMI, dropEST and BUStools format. Users can also set Location to a folder gs://fc-e0000000-0000-0000-0000-000000000000/my_dir/hg19_and_mm10/. This folder must be generated by Cell Ranger for multi-species samples and we expect one subfolder per species (e.g. ‘hg19’) and each subfolder should contain mtx file, barcode file, gene name file as generated by Cell Ranger.
  • csv format. If it is HCA DCP csv format, we expect the expression file has the name of expression.csv. In addition, we expect that cells.csv and genes.csv files are located under the same folder as the expression.csv. For example, gs://fc-e0000000-0000-0000-0000-000000000000/my_dir/sample_3/.
  • tsv or loom format.

Additionally, an optional Reference column can be used to select samples generated from a same reference (e.g. mm10). If the count matrix is in either DGE, mtx, csv, tsv, or loom format, the value in this column will be used as the reference since the count matrix file does not contain reference name information. The only exception is mtx format. If users do not provide a Reference column, we will use the basename of the folder containing the mtx file as its reference. In addition, the Reference column can be used to aggregate count matrices generated from different genome versions or gene annotations together under a unified reference. For example, if we have one matrix generated from mm9 and the other one generated from mm10, we can write mm9_10 for these two matrices in their Reference column. Pegasus will change their references to mm9_10 and use the union of gene symbols from the two matrices as the gene symbols of the aggregated matrix. For HDF5 files (e.g. 10x v2/v3), the reference name contained in the file does not need to match the value in this column. In fact, we use this column to rename references in HDF5 files. For example, if we have two HDF files, one generated from mm9 and the other generated from mm10. We can set these two files’ Reference column value to mm9_10, which will rename their reference names into mm9_10 and the aggregated matrix will contain all genes from either mm9 or mm10. This renaming feature does not work if one HDF5 file contain multiple references (e.g. mm10 and GRCh38).

You are free to add any other columns and these columns will be used in selecting channels for futher analysis. In the example below, we have Source, which refers to the tissue of origin, Platform, which refers to the sequencing platform, Donor, which refers to the donor ID, and Reference, which refers to the reference genome.

Example:

Sample,Source,Platform,Donor,Reference,Location
sample_1,bone_marrow,NextSeq,1,GRCh38,gs://fc-e0000000-0000-0000-0000-000000000000/my_dir/sample_1/raw_gene_bc_matrices_h5.h5
sample_2,bone_marrow,NextSeq,2,GRCh38,gs://fc-e0000000-0000-0000-0000-000000000000/my_dir/sample_2/raw_gene_bc_matrices_h5.h5
sample_3,pbmc,NextSeq,1,GRCh38,gs://fc-e0000000-0000-0000-0000-000000000000/my_dir/sample_3/raw_feature_bc_matrices.h5
sample_4,pbmc,NextSeq,2,GRCh38,gs://fc-e0000000-0000-0000-0000-000000000000/my_dir/sample_4/raw_feature_bc_matrices.h5

If you ran cellranger_workflow previously, you should already have a template count_matrix.csv file that you can modify from generate_count_config’s outputs.

  1. Upload your sample sheet to the workspace.

    Example:

    gsutil cp /foo/bar/projects/my_count_matrix.csv gs://fc-e0000000-0000-0000-0000-000000000000/
    

    where /foo/bar/projects/my_count_matrix.csv is the path to your sample sheet in local machine, and gs://fc-e0000000-0000-0000-0000-000000000000/ is the location on Google bucket to hold it.

  2. Import cumulus workflow to your workspace.

    See the Terra documentation for adding a workflow. The cumulus workflow is under Broad Methods Repository with name “cumulus/cumulus”.

    Moreover, in the workflow page, click the Export to Workspace... button, and select the workspace to which you want to export cumulus workflow in the drop-down menu.

  3. In your workspace, open cumulus in WORKFLOWS tab. Select Run workflow with inputs defined by file paths as below

    _images/single_workflow.png

    and click the SAVE button.

Case Two: Single File

Alternatively, if you only have one single count matrix for analysis, you can go without sample sheets. Cumulus currently supports the following formats:

  • 10x genomics v2/v3 format (hdf5);
  • Drop-seq dge format;
  • csv (no HCA DCP format), tsv or loom formats.

Simply upload your data to the Google Bucket of your workspace, and specify its URL in input_file field of Cumulus’ global inputs (see below). For hdf5 files, there is no need to specify genome names. For other formats, you can specify genome name in considered_refs field in cluster inputs; otherwise, default name '' will be used.

In this case, the aggregate_matrices step will be skipped.

Case Three: Multiple samples without aggregation

Sometimes, you may want to run Cumulus on multiple samples simultaneously. This is different from Case one, because samples are analyzed separately without aggregation.

  1. To do it, you need to first create a data table on Terra. An example TSV file is the following:

    entity:cumulus_test_id  input_h5
    5k_pbmc_v3  gs://fc-e0000000-0000-0000-0000-000000000000/5k_pbmc_v3/raw_feature_bc_matrix.h5
    1k_pbmc_v3  gs://fc-e0000000-0000-0000-0000-000000000000/1k_pbmc_v3/raw_feature_bc_matrix.h5
    

You are free to add more columns, but sample ids and URLs to RNA count matrix files are required. I’ll use this example TSV file for the rest of steps in this case.

  1. Upload your TSV file to your workspace. Open the DATA tab on your workspace. Then click the upload button on left TABLE panel, and select the TSV file above. When uploading is done, you’ll see a new data table with name “cumulus_test”:

    _images/data_table.png
  2. Import cumulus workflow to your workspace as in Case one. Then open cumulus in WORKFLOW tab. Select Run workflow(s) with inputs defined by data table, and choose cumulus_test from the drop-down menu.

    _images/multi_samples.png
  3. In the input field, specify:

  • input_file: Type this.input_h5, where this refers to the data table selected, and input_h5 is the column name in this data table for RNA count matrices.
  • output_directory: Type Google bucket URL for the main output folder. For example, gs://fc-e0000000-0000-0000-0000-000000000000/cumulus_results.
  • output_name: Type this.cumulus_test_id, where cumulus_test_id is the column name in data table for sample ids.

An example is in the screen shot below:

_images/multi_inputs.png

Then finish setting up other inputs following the description in sections below. When you are done, click SAVE, and then RUN ANALYSIS.

When all the jobs are done, you’ll find output for the 2 samples in subfolders gs://fc-e0000000-0000-0000-0000-000000000000/cumulus_results/5k_pbmc_v3 and gs://fc-e0000000-0000-0000-0000-000000000000/cumulus_results/1k_pbmc_v3, respectively.


Cumulus steps:

Cumulus processes single cell data in the following steps:

  1. aggregate_matrices (optional). When given a CSV format sample sheet, this step aggregates channel-specific count matrices into one big count matrix. Users can specify which channels they want to analyze and which sample attributes they want to import to the count matrix in this step. Otherwise, if a single count matrix file is given, skip this step.

  2. cluster. This is the main analysis step. In this step, Cumulus performs low quality cell filtration, highly variable gene selection, batch correction, dimension reduction, diffusion map calculation, graph-based clustering and 2D visualization calculation (e.g. t-SNE/UMAP/FLE).

  3. de_analysis. This step is optional. In this step, Cumulus can calculate potential markers for each cluster by performing a variety of differential expression (DE) analysis. The available DE tests include Welch’s t test, Fisher’s exact test, and Mann-Whitney U test. Cumulus can also calculate the area under ROC (AUROC) curve values for putative markers. If find_markers_lightgbm is on, Cumulus will try to identify cluster-specific markers by training a LightGBM classifier. If the samples are human or mouse immune cells, Cumulus can also optionally annotate putative cell types for each cluster based on known markers.

  4. plot. This step is optional. In this step, Cumulus can generate 6 types of figures based on the cluster step results:

    • composition plots which are bar plots showing the cell compositions (from different conditions) for each cluster. This type of plots is useful to fast assess library quality and batch effects.
    • tsne, fitsne, and net_tsne: t-SNE like plots based on different algorithms, respectively. Users can specify cell attributes (e.g. cluster labels, conditions) for coloring side-by-side.
    • umap and net_umap: UMAP like plots based on different algorithms, respectively. Users can specify cell attributes (e.g. cluster labels, conditions) for coloring side-by-side.
    • fle and net_fle: FLE (Force-directed Layout Embedding) like plots based on different algorithms, respectively. Users can specify cell attributes (e.g. cluster labels, conditions) for coloring side-by-side.
    • diffmap plots which are 3D interactive plots showing the diffusion maps. The 3 coordinates are the first 3 PCs of all diffusion components.
    • If input is CITE-Seq data, there will be citeseq_fitsne plots which are FIt-SNE plots based on epitope expression.
  5. cirro_output. This step is optional. Generate Cirrocumulus inputs for visualization using Cirrocumulus .

  6. scp_output. This step is optional. Generate analysis result in Single Cell Portal (SCP) compatible format.

In the following sections, we will first introduce global inputs and then introduce the WDL inputs and outputs for each step separately. But please note that you need to set inputs from all steps simultaneously in the Terra WDL.

Note that we will make the required inputs/outputs bold and all other inputs/outputs are optional.


global inputs
Name Description Example Default
input_file Input CSV sample sheet describing metadata of each 10x channel, or a single input count matrix file “gs://fc-e0000000-0000-0000-0000-000000000000/my_count_matrix.csv”  
output_directory Google bucket URL of the output directory. “gs://fc-e0000000-0000-0000-0000-000000000000/my_results_dir”  
output_name This is the name of subdirectory for the current sample; and all output files within the subdirectory will have this string as the common filename prefix. “my_sample”  
cumulus_version cumulus version to use. Versions available: 1.1.0, 1.0.0, 0.16.0, 0.15.0, 0.13.0, 0.12.0, 0.11.0, 0.10.0. “1.1.0” “1.1.0”
docker_registry

Docker registry to use. Options:

  • “quay.io/cumulus” for images on Red Hat registry;
  • “cumulusprod” for backup images on Docker Hub.
“quay.io/cumulus” “quay.io/cumulus”
zones Google cloud zones to consider for execution. “us-east1-d us-west1-a us-west1-b” “us-central1-a us-central1-b us-central1-c us-central1-f us-east1-b us-east1-c us-east1-d us-west1-a us-west1-b us-west1-c”
num_cpu Number of CPUs per Cumulus job 32 64
memory Memory size string “200G” “200G”
disk_space Total disk space in GB 100 100
preemptible Number of preemptible tries 2 2

aggregate_matrices
aggregate_matrices inputs
Name Description Example Default
restrictions Select channels that satisfy all restrictions. Each restriction takes the format of name:value,…,value. Multiple restrictions are separated by ‘;’ “Source:bone_marrow;Platform:NextSeq”  
attributes Specify a comma-separated list of outputted attributes. These attributes should be column names in the count_matrix.csv file “Source,Platform,Donor”  
select_only_singlets If we have demultiplexed data, turning on this option will make cumulus only include barcodes that are predicted as singlets. true false
minimum_number_of_genes Only keep barcodes with at least this number of expressed genes 100 100
is_dropseq If inputs are DropSeq data. false false
aggregate_matrices output
Name Type Description
output_aggr_zarr File Aggregated count matrix in Zarr format

cluster
cluster inputs
Name Description Example Default
focus
Focus analysis on Unimodal data with <keys>. <keys> is a comma-separated list of keys. If None, the self._selected will be the focused one.
Focus key consists of two parts: reference genome name, and data type, connected with a hyphen marker “-“.
Reference genome name depends on the reference you used when running Cellranger workflow. See details in reference list.
“GRCh38-rna”  
append
Append Unimodal data <key> to any <keys> in focus.
Similarly as focus keys, append key also consists of two parts: reference genome name, and data type, connected with a hyphen marker “-“.
See reference list for details.
“SARSCoV2-rna”  
channel Specify the cell barcode attribute to represent different samples. “Donor”  
black_list Cell barcode attributes in black list will be poped out. Format is “attr1,attr2,…,attrn”. “attr1,attr2,attr3””  
min_genes_before_filtration If raw data matrix is input, empty barcodes will dominate pre-filtration statistics. To avoid this, for raw data matrix, only consider barcodes with at lease <min_genes_before_filtration> genes for pre-filtration condition. 100 100
select_only_singlets If we have demultiplexed data, turning on this option will make cumulus only include barcodes that are predicted as singlets false false
remap_singlets
For demultiplexed data, user can remap singlet names using assignment in String in this input. This string assignment takes the format “new_name_i:old_name_1,old_name_2;new_name_ii:old_name_3;…”.
For example, if we hashed 5 libraries from 3 samples: sample1_lib1, sample1_lib2; sample2_lib1, sample2_lib2; sample3, we can remap them to 3 samples using this string: "sample1:sample1_lib1,sample1_lib2;sample2:sample2_lib1,sample2_lib2".
In this way, the new singlet names will be in metadata field with key assignment, while the old names are kept in metadata with key assignment.orig.
“Group1:CB1,CB2;Group2:CB3,CB4,CB5”  
subset_singlets
For demultiplexed data, user can use this input to choose a subset of singlets based on their names. This string takes the format “name1,name2,…”.
Note that if remap_singlets is specified, subsetting happens after remapping, i.e. you should use the new singlet names for choosing subset.
“Group2,CB6,CB7”  
output_filtration_results If write cell and gene filtration results to a spreadsheet true true
plot_filtration_results If plot filtration results as PDF files true true
plot_filtration_figsize Figure size for filtration plots. <figsize> is a comma-separated list of two numbers, the width and height of the figure (e.g. 6,4) 6,4  
output_h5ad Generate Seurat-compatible h5ad file. Must set to true if performing DE analysis, cell type annotation, or plotting. true true
output_loom If generate loom-formatted file false false
min_genes Only keep cells with at least <min_genes> of genes 500 500
max_genes Only keep cells with less than <max_genes> of genes 6000 6000
min_umis Only keep cells with at least <min_umis> of UMIs. By default, don’t filter cells due to UMI lower bound. 100  
max_umis Only keep cells with less than <max_umis> of UMIs. By default, don’t filter cells due to UMI upper bound. 600000  
mito_prefix Prefix of mitochondrial gene names. This is to identify mitochondrial genes. “mt-“
“MT-” for GRCh38 reference genome data;
“mt-” for mm10 reference genome data;
for other reference genome data, must specify this prefix manually.
percent_mito Only keep cells with mitochondrial ratio less than <percent_mito>% of total counts 50 20.0
gene_percent_cells Only use genes that are expressed in at <gene_percent_cells>% of cells to select variable genes 50 0.05
counts_per_cell_after Total counts per cell after normalization, before transforming the count matrix into Log space. 1e5 1e5
select_hvf_flavor

Highly variable feature selection method. Options:

  • “pegasus”: New selection method proposed in Pegasus, the analysis module of Cumulus workflow.
  • “Seurat”: Conventional selection method used by Seurat and SCANPY.
“pegasus” “pegasus”
select_hvf_ngenes Select top <select_hvf_ngenes> highly variable features. If <select_hvf_flavor> is “Seurat” and <select_hvf_ngenes> is “None”, select HVGs with z-score cutoff at 0.5. 2000 2000
no_select_hvf Do not select highly variable features. false false
plot_hvf Plot highly variable feature selection. Will not work if no_select_hvf is true. false false
correct_batch_effect If correct batch effects false false
correction_method

Batch correction method. Options:

  • “harmony”: Harmony algorithm (Korsunsky et al. Nature Methods 2019).
  • “L/S”: Location/Scale adjustment algorithm (Li and Wong. The analysis of Gene Expression Data, 2003).
  • “scanorama”: Scanorama algorithm (Hie et al. Nature Biotechnology 2019).
“harmony” “harmony”
batch_group_by
Batch correction assumes the differences in gene expression between channels are due to batch effects.
However, in many cases, we know that channels can be partitioned into several groups and each group is biologically different from others.
In this case, we will only perform batch correction for channels within each group. This option defines the groups.
If <expression> is None, we assume all channels are from one group. Otherwise, groups are defined according to <expression>.
<expression> takes the form of either ‘attr’, or ‘attr1+attr2+…+attrn’, or ‘attr=value11,…,value1n_1;value21,…,value2n_2;…;valuem1,…,valuemn_m’.
In the first form, ‘attr’ should be an existing sample attribute, and groups are defined by ‘attr’.
In the second form, ‘attr1’,…,’attrn’ are n existing sample attributes and groups are defined by the Cartesian product of these n attributes.
In the last form, there will be m + 1 groups.
A cell belongs to group i (i > 0) if and only if its sample attribute ‘attr’ has a value among valuei1,…,valuein_i.
A cell belongs to group 0 if it does not belong to any other groups
“Donor” None
random_state Random number generator seed 0 0
calc_signature_scores

Gene set for calculating signature scores. It can be either of the following forms:

  • String chosen from: cell_cycle_human, cell_cycle_mouse, gender_human, gender_mouse, mitochondrial_genes_human, mitochondrial_genes_mouse, robosomal_genes_human, robosomal_genes_mouse, apoptosis_human, and apoptosis_mouse.
  • Google bucket URL of a GMT format file. For example: gs://fc-e0000000-0000-0000-0000-000000000000/cell_cycle_sig.gmt.
“cell_cycle_human”  
nPC Number of principal components 50 50
knn_K Number of nearest neighbors used for constructing affinity matrix. 50 100
knn_full_speed For the sake of reproducibility, we only run one thread for building kNN indices. Turn on this option will allow multiple threads to be used for index building. However, it will also reduce reproducibility due to the racing between multiple threads. false false
run_diffmap Whether to calculate diffusion map or not. It will be automatically set to true when input run_fle or run_net_fle is set. false false
diffmap_ndc Number of diffusion components 100 100
diffmap_maxt Maximum time stamp in diffusion map computation to search for the knee point. 5000 5000
run_louvain Run Louvain clustering algorithm true true
louvain_resolution Resolution parameter for the Louvain clustering algorithm 1.3 1.3
louvain_class_label Louvain cluster label name in analysis result. “louvain_labels” “louvain_labels”
run_leiden Run Leiden clustering algorithm. false false
leiden_resolution Resolution parameter for the Leiden clustering algorithm. 1.3 1.3
leiden_niter Number of iterations of running the Leiden algorithm. If negative, run Leiden iteratively until no improvement. 2 -1
leiden_class_label Leiden cluster label name in analysis result. “leiden_labels” “leiden_labels”
run_spectral_louvain Run Spectral Louvain clustering algorithm false false
spectral_louvain_basis Basis used for KMeans clustering. Use diffusion map by default. If diffusion map is not calculated, use PCA coordinates. Users can also specify “pca” to directly use PCA coordinates. “diffmap” “diffmap”
spectral_louvain_resolution Resolution parameter for louvain. 1.3 1.3
spectral_louvain_class_label Spectral louvain label name in analysis result. “spectral_louvain_labels” “spectral_louvain_labels”
run_spectral_leiden Run Spectral Leiden clustering algorithm. false false
spectral_leiden_basis Basis used for KMeans clustering. Use diffusion map by default. If diffusion map is not calculated, use PCA coordinates. Users can also specify “pca” to directly use PCA coordinates. “diffmap” “diffmap”
spectral_leiden_resolution Resolution parameter for leiden. 1.3 1.3
spectral_leiden_class_label Spectral leiden label name in analysis result. “spectral_leiden_labels” “spectral_leiden_labels”
run_tsne Run FIt-SNE for visualization. false false
tsne_perplexity t-SNE’s perplexity parameter. 30 30
tsne_initialization Initialization method for FIt-SNE. It can be either: ‘random’ refers to random initialization; ‘pca’ refers to PCA initialization as described in [Kobak et al. 2019]. “pca” “pca”
run_umap Run UMAP for visualization true true
umap_K K neighbors for UMAP. 15 15
umap_min_dist UMAP parameter. 0.5 0.5
umap_spread UMAP parameter. 1.0 1.0
run_fle Run force-directed layout embedding (FLE) for visualization false false
fle_K Number of neighbors for building graph for FLE 50 50
fle_target_change_per_node Target change per node to stop FLE. 2.0 2.0
fle_target_steps Maximum number of iterations before stopping the algoritm 5000 5000
net_down_sample_fraction Down sampling fraction for net-related visualization 0.1 0.1
run_net_umap Run Net UMAP for visualization false false
net_umap_out_basis Basis name for Net UMAP coordinates in analysis result “net_umap” “net_umap”
run_net_fle Run Net FLE for visualization false false
net_fle_out_basis Basis name for Net FLE coordinates in analysis result. “net_fle” “net_fle”
infer_doublets Infer doublets using the Pegasus method. When finished, Scrublet-like doublet scores are in cell attribute doublet_score, and “doublet/singlet” assignment on cells are stored in cell attribute demux_type. false false
expected_doublet_rate The expected doublet rate per sample. If not specified, calculate the expected rate based on number of cells from the 10x multiplet rate table. 0.05  
doublet_cluster_attribute
Specify which cluster attribute (e.g. “louvain_labels”) should be used for doublet inference. Then doublet clusters will be marked with the following criteria: passing the Fisher’s exact test and having >= 50% of cells identified as doublets.
If not specified, the first computed cluster attribute in the list of “leiden”, “louvain”, “spectral_ledein” and “spectral_louvain” will be used.
“louvain_labels”  
citeseq
Perform CITE-Seq data analysis. Set to true if input data contain both RNA and CITE-Seq modalities.
This will set focus to be the RNA modality and append to be the CITE-Seq modality. In addition, "ADT-" will be added in front of each antibody name to avoid name conflict with genes in the RNA modality.
false false
citeseq_umap For high quality cells kept in the RNA modality, calculate a distinct UMAP embedding based on their antibody expression. false false
citeseq_umap_exclude A comma-separated list of antibodies to be excluded from the CITE-Seq UMAP calculation (e.g. Mouse-IgG1,Mouse-IgG2a). “Mouse-IgG1,Mouse-IgG2a”  
cluster outputs
Name Type Description
output_zarr File
Output file in zarr format (output_name.zarr.zip).
To load this file in Python, you need to first install PegasusIO on your local machine. Then use import pegasusio as io; data = io.read_input('output_name.zarr.zip') in Python environment.
data is a MultimodalData object, and points to its default UnimodalData element. You can set its default UnimodalData to others by data.set_data(focus_key) where focus_key is the key string to the wanted UnimodalData element.
For its default UnimodalData element, the log-normalized expression matrix is stored in data.X as a Scipy CSR-format sparse matrix, with cell-by-gene shape.
The obs field contains cell related attributes, including clustering results.
For example, data.obs_names records cell barcodes; data.obs['Channel'] records the channel each cell comes from;
data.obs['n_genes'], data.obs['n_counts'], and data.obs['percent_mito'] record the number of expressed genes, total UMI count, and mitochondrial rate for each cell respectively;
data.obs['louvain_labels'], data.obs['leiden_labels'], data.obs['spectral_louvain_labels'], and data.obs['spectral_leiden_labels'] record each cell’s cluster labels using different clustering algorithms;
The var field contains gene related attributes.
For example, data.var_names records gene symbols, data.var['gene_ids'] records Ensembl gene IDs, and data.var['highly_variable_features'] records selected variable genes.
The obsm field records embedding coordinates.
For example, data.obsm['X_pca'] records PCA coordinates, data.obsm['X_tsne'] records t-SNE coordinates,
data.obsm['X_umap'] records UMAP coordinates, data.obsm['X_diffmap'] records diffusion map coordinates,
data.obsm['X_diffmap_pca'] records the first 3 PCs by projecting the diffusion components using PCA,
and data.obsm['X_fle'] records the force-directed layout coordinates from the diffusion components.
The uns field stores other related information, such as reference genome (data.uns['genome']), kNN on PCA coordinates (data.uns['pca_knn_indices'] and data.uns['pca_knn_distances']), etc.
output_log File This is a copy of the logging module output, containing important intermediate messages
output_h5ad Array[File]
List of output file(s) in Seurat-compatible h5ad format (output_name.focus_key.h5ad), in which each file is associated with a focus of the input data.
To load this file in Python, first install PegasusIO on your local machine. Then use import pegasusio as io; data = io.read_input('output_name.focus_key.h5ad') in Python environment.
After loading, data has the similar structure as UnimodalData object in Description of output_zarr in cluster outputs section.
In addition, data.raw.X records filtered raw count matrix as a Scipy CSR-format sparse matrix, with cell-by-gene shape.
data.uns['scale.data'] records variable-gene-selected and standardized expression matrix which are ready to perform PCA, and data.uns['scale.data.rownames'] records indexes of the selected highly variable genes.
This file is used for loading in R and converting into a Seurat object (see here for instructions)
output_filt_xlsx File
Spreadsheet containing filtration results (output_name.filt.xlsx).
This file has two sheets — Cell filtration stats and Gene filtration stats.
The first sheet records cell filtering results and it has 10 columns:
Channel, channel name; kept, number of cells kept; median_n_genes, median number of expressed genes in kept cells; median_n_umis, median number of UMIs in kept cells;
median_percent_mito, median mitochondrial rate as UMIs between mitochondrial genes and all genes in kept cells;
filt, number of cells filtered out; total, total number of cells before filtration, if the input contain all barcodes, this number is the cells left after ‘min_genes_on_raw’ filtration;
median_n_genes_before, median expressed genes per cell before filtration; median_n_umis_before, median UMIs per cell before filtration;
median_percent_mito_before, median mitochondrial rate per cell before filtration.
The channels are sorted in ascending order with respect to the number of kept cells per channel.
The second sheet records genes that failed to pass the filtering.
This sheet has 3 columns: gene, gene name; n_cells, number of cells this gene is expressed; percent_cells, the fraction of cells this gene is expressed.
Genes are ranked in ascending order according to number of cells the gene is expressed.
Note that only genes not expressed in any cell are removed from the data.
Other filtered genes are marked as non-robust and not used for TPM-like normalization
output_filt_plot Array[File]
If not empty, this array contains 3 PDF files.
output_name.filt.gene.pdf, which contains violin plots contrasting gene count distributions before and after filtration per channel.
output_name.filt.UMI.pdf, which contains violin plots contrasting UMI count distributions before and after filtration per channel.
output_name.filt.mito.pdf, which contains violin plots contrasting mitochondrial rate distributions before and after filtration per channel
output_hvf_plot Array[File] If not empty, this array contains PDF files showing scatter plots of genes upon highly variable feature selection.
output_dbl_plot Array[File] If infer_doublets input field is true, this array will contain a number of png files, each corresponding to one sample/channel in the data. In each file, there are histograms showing the automated doublet rate selection of that sample/channel.
output_loom_file Array[File]
List of output file in loom format (output_name.focus_key.loom), in which each file is associated with a focus of the input data.
To load this file in Python, first install loompy. Then type from loompy import connect; ds = connect('output_name.focus_key.loom') in Python environment.
The log-normalized expression matrix is stored in ds with gene-by-cell shape. ds[:, :] returns the matrix in dense format; ds.layers[''].sparse() returns it as a Scipy COOrdinate sparse matrix.
The ca field contains cell related attributes as row attributes, including clustering results and cell embedding coordinates.
For example, ds.ca['obs_names'] records cell barcodes; ds.ca['Channel'] records the channel each cell comes from;
ds.ca['louvain_labels'], ds.ca['leiden_labels'], ds.ca['spectral_louvain_labels'], and ds.ca['spectral_leiden_labels'] record each cell’s cluster labels using different clustering algorithms;
ds.ca['X_pca'] records PCA coordinates, ds.ca['X_tsne'] records t-SNE coordinates,
ds.ca['X_umap'] records UMAP coordinates, ds.ca['X_diffmap'] records diffusion map coordinates,
ds.ca['X_diffmap_pca'] records the first 3 PCs by projecting the diffusion components using PCA,
and ds.ca['X_fle'] records the force-directed layout coordinates from the diffusion components.
The ra field contains gene related attributes as column attributes.
For example, ds.ra['var_names'] records gene symbols, ds.ra['gene_ids'] records Ensembl gene IDs, and ds.ra['highly_variable_features'] records selected variable genes.

de_analysis
de_analysis inputs
Name Description Example Default
perform_de_analysis Whether perform differential expression (DE) analysis. If performing, by default calculate AUROC scores and Mann-Whitney U test. true true
cluster_labels Specify the cluster label used for DE analysis “louvain_labels” “louvain_labels”
alpha Control false discovery rate at <alpha> 0.05 0.05
fisher Calculate Fisher’s exact test true true
t_test Calculate Welch’s t-test. true true
find_markers_lightgbm If also detect markers using LightGBM false false
remove_ribo Remove ribosomal genes with either RPL or RPS as prefixes. Currently only works for human data false false
min_gain Only report genes with a feature importance score (in gain) of at least <gain> 1.0 1.0
annotate_cluster If also annotate cell types for clusters based on DE results false false
annotate_de_test Differential Expression test to use for inference on cell types. Options: mwu, t, or fisher “mwu” “mwu”
organism

Organism, could either of the follow:

  • Preset markers: human_immune, mouse_immune, human_brain, mouse_brain, human_lung, or a combination of them as a string separated by comma.
  • User-defined marker file: A Google bucket link to a user-specified JSON file describing the markers. For example: gs://fc-e0000000/my_markers.json.
“mouse_immune,mouse_brain” “human_immune”
minimum_report_score Minimum cell type score to report a potential cell type 0.5 0.5
de_analysis outputs
Name Type Description
output_de_h5ad Array[File]
List of h5ad-formatted results with DE results updated (output_name.focus_key.h5ad), in which each file is associated with a focus of the input data.
To load this file in Python, you need to first install PegasusIO on your local machine. Then type import pegasusio as io; data = io.read_input('output_name.focus_key.h5ad') in Python environment.
After loading, data has the similar structure as UnimodalData object in Description of output_zarr in cluster outputs section.
Besides, there is one additional field varm which records DE analysis results in data.varm['de_res']. You can use Pandas DataFrame to convert it into a reader-friendly structure: import pandas as pd; df = pd.DataFrame(data.varm['de_res'], index = data.var_names). Then in the resulting data frame, genes are rows, and those DE test statistics are columns.
DE analysis in cumulus is performed on each cluster against cells in all the other clusters. For instance, in the data frame, column mean_logExpr:1 refers to the mean expression of genes in log-scale for cells in Cluster 1. The number after colon refers to the cluster label to which this statistic belongs.
output_de_xlsx Array[File]
List of spreadsheets reporting DE results (output_name.focus_key.de.xlsx), in which each file is associated with a focus of the input data.
Each cluster has two tabs: one for up-regulated genes for this cluster, one for down-regulated ones. In each tab, genes are ranked by AUROC scores.
Genes which are not significant in terms of q-values in any of the DE test are not included (at false discovery rate specified in alpha field of de_analysis inputs).
output_markers_xlsx Array[File] List of Excel spreadsheets containing detected markers (output_name.focus_key.markers.xlsx), in which each file is associated with a focus of the input data. Each cluster has one tab in the spreadsheet and each tab has three columns, listing markers that are strongly up-regulated, weakly up-regulated and down-regulated.
output_anno_file Array[File] List of cluster-based cell type annotation files (output_name.focus_key.anno.txt), in which each file is associated with a focus of the input data.
How cell type annotation works

In this subsection, we will describe the format of input JSON cell type marker file, the ad hoc cell type inference algorithm, and the format of the output putative cell type file.

JSON file

The top level of the JSON file is an object with two name/value pairs:

  • title: A string to describe what this JSON file is for (e.g. “Mouse brain cell markers”).

  • cell_types: List of all cell types this JSON file defines. In this list, each cell type is described using a separate object with 2 to 3 name/value pairs:

    • name: Cell type name (e.g. “GABAergic neuron”).

    • markers: List of gene-marker describing objects, each of which has 2 name/value pairs:

      • genes: List of positive and negative gene markers (e.g. ["Rbfox3+", "Flt1-"]).
      • weight: A real number between 0.0 and 1.0 to describe how much we trust the markers in genes.

    All markers in genes share the weight evenly. For instance, if we have 4 markers and the weight is 0.1, each marker has a weight of 0.1 / 4 = 0.025.

    The weights from all gene-marker describing objects of the same cell type should sum up to 1.0.

    • subtypes: Description on cell subtypes for the cell type. It has the same structure as the top level JSON object.

See below for an example JSON snippet:

{
  "title" : "Mouse brain cell markers",
    "cell_types" : [
      {
        "name" : "Glutamatergic neuron",
        "markers" : [
          {
            "genes" : ["Rbfox3+", "Reln+", "Slc17a6+", "Slc17a7+"],
            "weight" : 1.0
          }
        ],
        "subtypes" : {
          "title" : "Glutamatergic neuron subtype markers",
            "cell_types" : [
              {
                "name" : "Glutamatergic layer 4",
                "markers" : [
                  {
                    "genes" : ["Rorb+", "Paqr8+"],
                    "weight" : 1.0
                  }
                ]
              }
            ]
        }
      }
    ]
}
Inference Algorithm

We have already calculated the up-regulated and down-regulated genes for each cluster in the differential expression analysis step.

First, load gene markers for each cell type from the JSON file specified, and exclude marker genes, along with their associated weights, that are not expressed in the data.

Then scan each cluster to determine its putative cell types. For each cluster and putative cell type, we calculate a score between 0 and 1, which describes how likely cells from the cluster are of this cell type. The higher the score is, the more likely cells are from the cell type.

To calculate the score, each marker is initialized with a maximum impact value (which is 2). Then do case analysis as follows:

  • For a positive marker:

    • If it is not up-regulated, its impact value is set to 0.

    • Otherwise, if it is up-regulated:

      • If it additionally has a fold change in percentage of cells expressing this marker (within cluster vs. out of cluster) no less than 1.5, it has an impact value of 2 and is recorded as a strong supporting marker.
      • If its fold change (fc) is less than 1.5, this marker has an impact value of 1 + (fc - 1) / 0.5 and is recorded as a weak supporting marker.
  • For a negative marker:

    • If it is up-regulated, its impact value is set to 0.

    • If it is neither up-regulated nor down-regulated, its impact value is set to 1.

    • Otherwise, if it is down-regulated:

      • If it additionally has 1 / fc (where fc is its fold change) no less than 1.5, it has an impact value of 2 and is recorded as a strong supporting marker.
      • If 1 / fc is less than 1.5, it has an impact value of 1 + (1 / fc - 1) / 0.5 and is recorded as a weak supporting marker.

The score is calculated as the weighted sum of impact values weighted over the sum of weights multiplied by 2 from all expressed markers. If the score is larger than 0.5 and the cell type has cell subtypes, each cell subtype will also be evaluated.

Output annotation file

For each cluster, putative cell types with scores larger than minimum_report_score will be reported in descending order with respect to their scores. The report of each putative cell type contains the following fields:

  • name: Cell type name.
  • score: Score of cell type.
  • average marker percentage: Average percentage of cells expressing marker within the cluster between all positive supporting markers.
  • strong support: List of strong supporting markers. Each marker is represented by a tuple of its name and percentage of cells expressing it within the cluster.
  • weak support: List of week supporting markers. It has the same structure as strong support.

plot

The h5ad file contains a default cell attribute Channel, which records which channel each that single cell comes from. If the input is a CSV format sample sheet, Channel attribute matches the Sample column in the sample sheet. Otherwise, it’s specified in channel field of the cluster inputs.

Other cell attributes used in plot must be added via attributes field in the aggregate_matrices inputs.

plot inputs
Name Description Example Default
plot_composition
Takes the format of “label:attr,label:attr,…,label:attr”.
If non-empty, generate composition plot for each “label:attr” pair.
“label” refers to cluster labels and “attr” refers to sample conditions
“louvain_labels:Donor” None
plot_tsne
Takes the format of “attr,attr,…,attr”.
If non-empty, plot attr colored FIt-SNEs side by side
“louvain_labels,Donor” None
plot_umap
Takes the format of “attr,attr,…,attr”.
If non-empty, plot attr colored UMAP side by side
“louvain_labels,Donor” None
plot_fle
Takes the format of “attr,attr,…,attr”.
If non-empty, plot attr colored FLE (force-directed layout embedding) side by side
“louvain_labels,Donor” None
plot_net_umap
Takes the format of “attr,attr,…,attr”.
If non-empty, plot attr colored UMAP side by side based on net UMAP result.
“leiden_labels,Donor” None
plot_net_fle
Takes the format of “attr,attr,…,attr”.
If non-empty, plot attr colored FLE (force-directed layout embedding) side by side
based on net FLE result.
“leiden_labels,Donor” None
plot_citeseq_umap
Takes the format of “attr,attr,…,attr”.
If non-empty, plot attr colored UMAP side by side based on CITE-Seq UMAP result.
“louvain_labels,Donor” None
plot outputs
Name Type Description
output_pdfs Array[File] Outputted pdf files
output_htmls Array[File] Outputted html files

Generate input files for Cirrocumulus

Generate Cirrocumulus inputs for visualization using Cirrocumulus .

cirro_output inputs
Name Description Example Default
generate_cirro_inputs Whether to generate input files for Cirrocumulus false false
cirro_output outputs
Name Type Description
output_cirro_path Google Bucket URL Path to Cirrocumulus inputs

Generate SCP-compatible output files

Generate analysis result in Single Cell Portal (SCP) compatible format.

scp_output inputs
Name Description Example Default
generate_scp_outputs Whether to generate SCP format output or not. false false
output_dense Output dense expression matrix, instead of the default sparse matrix format. false false
scp_output outputs
Name Type Description
output_scp_files Array[File] Outputted SCP format files.

Run CITE-Seq analysis

Users now can use cumulus/cumulus workflow solely to run CITE-Seq analysis.

  1. Prepare a sample sheet in the following format:

    Sample,Location,Modality
    sample_1,gs://your-bucket/rna_raw_counts.h5,rna
    sample_1,gs://your-bucket/citeseq_cell_barcodes.csv,citeseq
    

Each row stands for one modality:

  • Sample: Sample name, which must be the same in the two rows to let Cumulus aggregate RNA and CITE-Seq matrices.
  • Location: Google bucket URL of the corresponding count matrix file.
  • Modality: Modality type. rna for RNA count matrix; citeseq for CITE-Seq antibody count matrix.
  1. Run cumulus/cumulus workflow using this sample sheet as the input file, and specify the following input fields:

    • citeseq: Set this to true to enable CITE-Seq analysis.
    • citeseq_umap: Set this to true to calculate the CITE-Seq UMAP embedding on cells.
    • citeseq_umap_exclude: A list of CITE-Seq antibodies to be excluded from UMAP calculation. This list should be written in a string format with each antobidy name separated by comma.
    • plot_citeseq_umap: A list of cell barcode attributes to be plotted based on CITE-Seq UMAP embedding. This list should be written in a string format with each attribute separated by comma.

Load Cumulus results into Pegasus

Pegasus is a Python package for large-scale single-cell/single-nucleus data analysis, and it uses PegasusIO for read/write. To load Cumulus results into Pegasus, we provide instructions based on file format:

  • zarr: Annotated Zarr file in zip format. This is the standard output format of Cumulus. You can load it by:

    import pegasusio as io
    data = io.read_input("output_name.zarr.zip")
    
  • h5ad: When setting “output_h5ad” field in Cumulus cluster to true, a list of annotated H5AD file(s) will be generated besides Zarr result. If the input data have multiple foci, Cumulus will generate one H5AD file per focus. You can load it by:

    import pegasusio as io
    adata = io.read_input("output_name.focus_key.h5ad")
    

Sometimes you may also want to specify how the result is loaded into memory. In this case, read_input has argument mode. Please see its documentation for details.

  • loom: When setting “output_loom” field in Cumulus cluster to true, a list of loom format file(s) will be generated besides Zarr result. Similarly as H5AD output, Cumulus generates multiple loom files if the input data have more than one foci. To load loom file, you can optionally set its genome name in the following way as this information is not contained by loom file:

    import pegasusio as io
    data = pg.read_input("output_name.focus_key.loom", genome = "GRCh38")
    

After loading, Pegasus manipulate the data matrix in PegasusIO MultimodalData structure.


Load Cumulus results into Seurat

Seurat is a single-cell data analysis package written in R.

Load H5AD File into Seurat

First, you need to set “output_h5ad” field to true in cumulus cluster inputs to generate Seurat-compatible output files output_name.focus_key.h5ad, in addition to the standard result output_name.zarr.zip. If the input data have multiple foci, Cumulus will generate one H5AD file per focus.

Notice that Python, and Python package anndata with version at least 0.6.22.post1, and R package reticulate are required to load the result into Seurat.

Execute the R code below to load the h5ad result into Seurat (working with both Seurat v2 and v3):

source("https://raw.githubusercontent.com/klarman-cell-observatory/cumulus/master/workflows/cumulus/h5ad2seurat.R")
ad <- import("anndata", convert = FALSE)
test_ad <- ad$read_h5ad("output_name.focus_key.h5ad")
result <- convert_h5ad_to_seurat(test_ad)

The resulting Seurat object result has three data slots:

  • raw.data records filtered raw count matrix.
  • data records filtered and log-normalized expression matrix.
  • scale.data records variable-gene-selected, standardized expression matrix that are ready to perform PCA.
Load loom File into Seurat

First, you need to set “output_loom” field to true in cumulus cluster inputs to generate a loom format output file, say output_name.focus_key.loom, in addition to the standard result output_name.zarr.zip. If the input data have multiple foci, Cumulus will generate one loom file per focus.

You also need to install loomR package in your R environment:

install.package("devtools")
devtools::install_github("mojaveazure/loomR", ref = "develop")

Execute the R code below to load the loom file result into Seurat (working with Seurat v3 only):

source("https://raw.githubusercontent.com/klarman-cell-observatory/cumulus/master/workflows/cumulus/loom2seurat.R")
result <- convert_loom_to_seurat("output_name.focus_key.loom")

In addition, if you want to set an active cluster label field for the resulting Seurat object, do the following:

Idents(result) <- result@meta.data$louvain_labels

where louvain_labels is the key to the Louvain clustering result in Cumulus, which is stored in cell attributes result@meta.data.


Load Cumulus results into SCANPY

SCANPY is another Python package for single-cell data analysis. We provide instructions on loading Cumulus output into SCANPY based on file format:

  • h5ad: Annotated H5AD file. This is the standard output format of Cumulus:

    import scanpy as sc
    adata = sc.read_h5ad("output_name.h5ad")
    

Sometimes you may also want to specify how the result is loaded into memory. In this case, read_h5ad has argument backed. Please see SCANPY documentation for details.

  • loom: This format is generated when setting “output_loom” field in Cumulus cluster to true:

    import scanpy as sc
    adata = sc.read_loom("output_name.loom")
    

Besides, read_loom has a boolean sparse argument to decide whether to read the data matrix as sparse, with default value True. If you want to load it as a dense matrix, simply type:

adata = sc.read_loom("output_name.loom", sparse = False)

After loading, SCANPY manipulates the data matrix in anndata structure.


Visualize Cumulus results in Python

Ensure you have Pegasus installed.

Download your analysis result data, say output_name.zarr.zip, from Google bucket to your local machine.

Follow Pegasus plotting tutorial for visualizing your data in Python.

Run Terra pipelines via command line

You can run Terra pipelines via the command line by installing the altocumulus package.

Install altocumulus for Broad users

Request an UGER node:

reuse UGER
qrsh -q interactive -l h_vmem=4g -pe smp 8 -binding linear:8 -P regevlab

The above command requests an interactive shell using the regevlab project with 4G memory per thread, 8 threads. Feel free to change the memory, thread, and project parameters.

Add conda to your path:

reuse Anaconda3

Activate the alto virtual environment:

source activate /seq/regev_genome_portal/conda_env/cumulus

Install altocumulus for non-Broad users

  1. Make sure you have conda installed. If you haven’t installed conda, use the following commands to install it on Linux:

    wget https://repo.continuum.io/miniconda/Miniconda3-latest-Linux-x86_64.sh .
    bash Miniconda3-latest-Linux-x86_64.sh -p /home/foo/miniconda3
    mv Miniconda3-latest-Linux-x86_64.sh /home/foo/miniconda3
    

    where /home/foo/miniconda3 should be replaced by your own folder holding Miniconda3.

Or use the following commdands for MacOS installation:

curl -O curl -O https://repo.anaconda.com/miniconda/Miniconda3-latest-MacOSX-x86_64.sh
bash Miniconda3-latest-MacOSX-x86_64.sh -p /Users/foo/miniconda3
mv Miniconda3-latest-MacOSX-x86_64.sh /Users/foo/miniconda3

where ``/Users/foo/miniconda3`` should be replaced by your own folder holding Miniconda3.
  1. Create a conda environment named “alto” and install altocumulus:

    conda create -n alto -y pip
    source activate alto
    pip install altocumulus
    

When the installation is done, type alto -h in terminal to see if you can see the help information.

Set up Google Cloud Account

Install Google Cloud SDK on your local machine.

Then type the following command in your terminal

gcloud auth application-default login

and follow the pop-up instructions to set up your Google cloud account.

Run Terra workflows via alto run

alto run runs a Terra method. Features:

  • Uploads local files/directories in your inputs to a Google Cloud bucket updates the file paths to point to the Google Cloud bucket.

    Your sample sheet can point to local file paths. In this case, alto run will take care of uploading directories smartly (e.g. only upload necessary files in BCL folders) and modifying the sample sheet to point to a Google Cloud bucket.

  • Creates or uses an existing workspace.

  • Uses the latest version of a method unless the method version is specified.

Options

Required options are in bold.

Name Description
-m <METHOD>
--method <METHOD>
Specify a Terra workflow <METHOD> to use.
<METHOD> is of format Namespace/Name (e.g. cumulus/cellranger_workflow).
A snapshot version number can optionally be specified (e.g. cumulus/cellranger_workflow/4); otherwise the latest snapshot of the method is used.
-w <WORKSPACE>
--workspace <WORKSPACE>
Specify which Terra workspace <WORKSPACE> to use.
<WORKSPACE> is also of format Namespace/Name (e.g. foo/bar). The workspace will be created if it does not exist.
-i <WDL_INPUTS>
--inputs <WDL_INPUTS>
Specify the WDL input JSON file to use.
It can be a local file, a JSON string, or a Google bucket URL directing to a remote JSON file.
--bucket-folder <folder>
Store inputs to <folder> under workspace’s google bucket.
-o <updated_json>
--upload <updated_json>
Upload files/directories to Google bucket of the workspace, and generate an updated input JSON file (with local paths replaced by Google bucket URLs) to <updated_json> on local machine.
--no-cache
Disable Terra cache calling
Example

This example shows how to use alto run to run cellranger_workflow to extract gene-count matrices from sequencing output.

  1. Prepare your sample sheet example_sample_sheet.csv as the following:

    Sample,Reference,Flowcell,Lane,Index,Chemistry
    sample_1,GRCh38,/my-local-path/flowcell1,1-2,SI-GA-A8,threeprime
    sample_2,GRCh38,/my-local-path/flowcell1,3-4,SI-GA-B8,threeprime
    sample_3,mm10,/my-local-path/flowcell1,5-6,SI-GA-C8,fiveprime
    sample_4,mm10,/my-local-path/flowcell1,7-8,SI-GA-D8,fiveprime
    sample_1,GRCh38,/my-local-path/flowcell2,1-2,SI-GA-A8,threeprime
    sample_2,GRCh38,/my-local-path/flowcell2,3-4,SI-GA-B8,threeprime
    sample_3,mm10,/my-local-path/flowcell2,5-6,SI-GA-C8,fiveprime
    sample_4,mm10,/my-local-path/flowcell2,7-8,SI-GA-D8,fiveprime
    

    where /my-local-path is the top-level directory of your BCL files on your local machine.

    Note that sample_1, sample_2, sample_3, and sample_4 are sequenced on 2 flowcells.

  2. Prepare your JSON input file inputs.json for cellranger_workflow:

    {
        "cellranger_workflow.input_csv_file" : "/my-local-path/sample_sheet.csv",
        "cellranger_workflow.output_directory" : "gs://url/outputs",
        "cellranger_workflow.delete_input_bcl_directory": true
    }
    

    where gs://url/outputs is the folder on Google bucket of your workspace to hold output.

  3. Run the following command to kick off your Terra workflow:

    alto run -m cumulus/cellranger_workflow -i inputs.json -w myworkspace_namespace/myworkspace_name -o inputs_updated.json
    

    where myworkspace_namespace/myworkspace_name should be replaced by your workspace namespace and name.

Upon success, alto run returns a URL pointing to the submitted Terra job for you to monitor.

If for any reason, your job failed. You could rerun it without uploading files again via the following command:

alto run -m cumulus/cellranger_workflow -i inputs_updated.json -w myworkspace_namespace/myworkspace_name

because inputs_updated.json is the updated version of inputs.json with all local paths being replaced by their corresponding Google bucket URLs after uploading.

Examples

Example of Cell-Hashing and CITE-Seq Analysis on Cloud

In this example, you’ll learn how to perform Cell-Hashing and CITE-Seq analysis using cumulus on Terra.


0. Workspace and Data Preparation

After registering on Terra and creating a workspace there, you’ll need the following two information:

  • Terra workspace name. This is shown on your Terra workspace webpage, with format “<workspace-namespace>/<workspace-name>”. Let it be ws-lab/ws-01 in this example, which means that your workspace has namespace ws-lab and name ws-01.
  • The corresponding Google Cloud Bucket of your workspace. You can check it under “Google Bucket” title on the right panel of your Terra workspace’s Dashboard tab. The bucket name associated with your workspace starts with fc- followed by a sequence of heximal numbers. In this example, let it be: gs://fc-e0000000, where “gs://” is the head of Google bucket URL.

Then upload your BCL directories to Google bucket of your workspace using gsutil:

gsutil -m cp -r /my-local-path/BCL/* gs://fc-e0000000/data-source

where option -m means copy in parallel, -r means copy the directory recursively, /my-local-path/BCL is the path to the top-level directory of your BCL files on your local machine, and data-source is the folder on Google bucket to hold the uploaded data.


1. Extract Gene-Count Matrices

First step is to extract gene-count matrices from sequencing output.

You need two original files from your dataset to start:

  • Cell-Hashing Index CSV file, say its filename is cell_hashing_index.csv, of format “feature_barcode,feature_name”. See an example below:

    AATCATCACAAGAAA,CB1
    GGTCACTGTTACGTA,CB2
    ... ...
    

    where each line is a pair of feature barcode and feature name of a sample.

  • CITE-Seq Index CSV file, say its filename is cite_seq_index.csv, of the same format as above. See an example below:

    TTACATGCATTACGA,CD19
    GCATTAGCATGCAGC,HLA-ABC
    ... ...
    

    where each line is a pair of Barcode and Specificity of an Antibody.

Then upload them to your Google Bucket using gsutil. Assuming both files are in folder /Users/foo/data-source on your local machine, type the following command to upload:

gsutil -m cp -r /Users/foo/data-source gs://fc-e0000000/data-source

where gs://fc-e0000000/data-source is your working directory at cloud side, which can be changed at your will.

Next, create a sample sheet, cellranger_sample_sheet.csv, for Cell Ranger processing. Below is an example:

Sample,Reference,Flowcell,Lane,Index,DataType,FeatureBarcodeFile
sample_control,GRCh38,gs://fc-e0000000/data-source,2,SI-GA-F1,rna
sample_cc,GRCh38,gs://fc-e0000000/data-source,3,SI-GA-A1,rna
sample_cell_hashing,GRCh38,gs://fc-e0000000/data-source,3,ATTACTCG,adt,cell_hashing_index.csv
sample_cite_seq,GRCh38,gs://fc-e0000000/data-source,3,CGTGAT,adt,cite_seq_index.csv

For the details on how to prepare this sample sheet, please refer to Step 3 of Cell Ranger sample sheet instruction.

When you are done with the sample sheet, upload it to Google bucket:

gsutil cp cellranger_sample_sheet.csv gs://fc-e0000000/my-dir/

Now we are ready to set up cellranger_workflow workflow for this phase. If your workspace doesn’t have this workflow, import it to your workspace by following cellranger_workflow import instructions.

Then prepare a JSON file, cellranger_inputs.json, which is used to set up the workflow inputs:

{
        "cellranger_workflow.input_csv_file" : "gs://fc-e0000000/my-dir/cellranger_sample_sheet.csv",
        "cellranger_workflow.output_directory" : "gs://fc-e0000000/my-dir"
}

where gs://fc-e0000000/my-dir is the remote directory in which the output of cellranger_workflow will be generated. For the details on the options above, please refer to Cell Ranger workflow inputs.

When you are done with the JSON file, on cellranger_workflow workflow page, upload cellranger_inputs.json by clicking upload json link as below:

_images/upload_json.png

Then Click SAVE button to save the inputs, and click RUN ANALYSIS button as below to start the job:

_images/run_analysis.png

When the execution is done, all the output results will be in folder gs://fc-e0000000/my-dir.

For the next phases, you’ll need 3 files from the output:

  • RNA count matrix of the sample group of interest: gs://fc-e0000000/my-dir/sample_cc/raw_feature_bc_matrix.h5;
  • Cell-Hashing Antibody count matrix: gs://fc-e0000000/my-dir/sample_cell_hashing/sample_cell_hashing.csv;
  • CITE-Seq Antibody count matrix: gs://fc-e0000000/my-dir/sample_cite_seq/sample_cite_seq.csv.

2. Demultiplex Cell-Hashing Data
  1. Prepare a sample sheet, demux_sample_sheet.csv, with the following content:

    OUTNAME,RNA,TagFile,TYPE
    exp,gs://fc-e0000000/my-dir/raw_feature_bc_matrix.h5,gs://fc-e0000000/my-dir/sample_cell_hashing.csv,cell-hashing
    

    where OUTNAME specifies the subfolder and file names of output, which is free to change, RNA and TagFile columns specify the RNA and hashing tag meta-data of samples, and TYPE is cell-hashing for this phase.

    Then upload it to Google bucket:

    gsutil cp demux_sample_sheet.csv gs://fc-e0000000/my-dir/
    
  2. If your workspace doesn’t have demultiplexing workflow, import it to your workspace by following Step 2 of demultiplexing workflow preparation instructions.

  3. Prepare an input JSON file, demux_inputs.json with the following content to set up cumulus_hashing_cite_seq workflow inputs:

    {
            "demultiplexing.input_sample_sheet" : "gs://fc-e0000000/my-dir/demultiplex_sample_sheet.csv",
            "demultiplexing.output_directory" : "gs://fc-e0000000/my-dir/"
    }
    

    For the details on these options, please refer to demultiplexing workflow inputs.

  4. On the page of demultiplexing workflow, upload demux_inputs.json by clicking upload json link. Save the inputs, and click RUN ANALYSIS button to start the job.

When the execution is done, you’ll get a processed file, exp_demux.zarr.zip, stored on cloud in directory gs://fc-e0000000/my-dir/exp/.


3. Data Analysis on CITE-Seq Data

In this step, we need to merge RNA and ADT matrices for CITE-Seq data, and perform the downstream analysis.

  1. Prepare a sample sheet, cumulus_count_matrix.csv, with the following content:

    Sample,Location,Modality
    exp,gs://fc-e0000000/my-dir/exp/exp_demux.zarr.zip,rna
    exp,gs://fc-e0000000/my-dir/sample_cite_seq/sample_cite_seq.csv,citeseq
    

    This sample sheet describes the metadata for each modality (as one row in the sheet):

    • Sample specifies the name of the modality, and all modalities must have the same name, as otherwise their count matrices won’t be aggregated together;
    • Location specifies the file location. For RNA data, it’s the output of Phase 2; for CITE-Seq antibody data, it’s the output of Phase 1.
    • Modality specifies the modality type, which is either rna for RNA matrix, or citeseq for CITE-Seq antibody matrix.

    Then upload it to Google bucket:

    gsutil cp cumulus_count_matrix.csv gs://fc-e0000000/my-dir/
    
  2. If your workspace doesn’t have cumulus workflow, import it to your workspace by following Step 2 and 3 of cumulus documentation.

  3. Prepare a JSON file, cumulus_inputs.json with the following content to set up cumulus workflow inputs:

    {
            "cumulus.input_file" : "gs://fc-e0000000/my-dir/cumulus_count_matrix.csv",
            "cumulus.output_directory" : "gs://fc-e0000000/my-dir/results",
            "cumulus.output_name" : "exp_merged_out",
            "cumulus.select_only_singlets" : true,
            "cumulus.run_louvain" : true,
            "cumulus.run_umap" : true,
            "cumulus.citeseq" : true,
            "cumulus.citeseq_umap" : true,
            "cumulus.citeseq_umap_exclude" : "Mouse_IgG1,Mouse_IgG2a,Mouse_IgG2b,Rat_IgG2b",
            "cumulus.plot_composition" : "louvain_labels:assignment",
            "cumulus.plot_umap" : "louvain_labels,assignment",
            "cumulus.plot_citeseq_umap" : "louvain_labels,assignment",
            "cumulus.cluster_labels" : "louvain_labels",
            "cumulus.annotate_cluster" : true
    }
    

    A typical cumulus pipeline consists of 4 steps, which is given here. For the details of options above, please refer to cumulus inputs.

  4. On the page of cumulus workflow, upload cumulus_inputs.json by clicking upload json link. Save the inputs, and click RUN ANALYSIS button to start the job.

When the execution is done, you’ll get the following results stored on cloud gs://fc-e0000000/my-dir/results/exp_merged_out/ to check:

  • exp_merged_out.aggr.zarr.zip: The ZARR format file containing both the aggregated count matrix in <genome>-rna modality, as well as CITE-Seq antibody count matrix in <genome>-citeseq modality, where <genome> is the genome reference name of your count matrices, e.g. GRCh38.
  • exp_merged_out.zarr.zip: The ZARR format file containing the analysis results in <genome>-rna modality, and CITE-Seq antibody count matrix in <genome>-citeseq modality.
  • exp_merged_out.<genome>-rna.h5ad: The processed RNA matrix data in H5AD format.
  • exp_merged_out.<genome>-rna.filt.xlsx: The Quality-Control (QC) summary of the raw data.
  • exp_merged_out.<genome>-rna.filt.{UMI, gene, mito}.pdf: The QC plots of the raw data.
  • exp_merged_out.<genome>-rna.de.xlsx: Differential Expression analysis result.
  • exp_merged_out.<genome>-rna.anno.txt: Cell type annotation output.
  • exp_merged_out.<genome>-rna.umap.pdf: UMAP plot.
  • exp_merged_out.<genome>-rna.citeseq.umap.pdf: CITE-Seq UMAP plot.
  • exp_merged_out.<genome>-rna.louvain_labels.assignment.composition.pdf: Composition plot.

You can directly go to your Google Bucket to view or download these results.


(optional) Run Terra Workflows in Command Line

For Phase 1, 2, and 3, besides uploading sample sheets and setting-up workflow inputs on workflow pages, you can also start the workflow execution via command line using altocumulus tool.

First, install altocumulus by following altocumulus installation instruction.

  1. For Phase 1 above, when you are done with creating a sample sheet cellranger_sample_sheet.csv on your local machine, in the same directory, prepare JSON file cellranger_inputs.json as below:

    {
            "cellranger_workflow.input_csv_file" : "cellranger_sample_sheet.csv",
            ... ...
    }
    

    where all the rest parameters remain the same as in Phase 1. Import cellranger_workflow workflow to your workspace as usual.

    Now run the following command in the same directory on your local machine:

    alto run -m cumulus/cellranger_workflow -w ws-lab/ws-01 --bucket-folder my-dir -i cellranger_input.json
    

    Notice that if the execution failed, you could rerun the execution by setting cellranger_input_updated.json for -i option to use the sample sheet already uploaded to Google bucket. Similarly below.

  2. For Phase 2 above, similarly, in the same directory of your demux_sample_sheet.csv file, prepare JSON file demux_inputs.json as below:

    {
            "demultiplexing.input_sample_sheet" : "demux_sample_sheet.csv",
            ... ...
    }
    

    where all the rest parameters remain the same as in Phase 2. Import demultiplexing workflow to your workspace as usual.

    Run the following command in the same directory on your local machine:

    alto run -m cumulus/demultiplexing -w ws-lab/ws-01 --bucket-folder my-dir -i demux_inputs.json
    
  3. For Phase 3 above, similarly, in the same directory of your cumulus_count_matrix.csv file, prepare JSON file cumulus_inputs.json as below:

    {
            "cumulus.input_file" : "cumulus_count_matrix.csv",
            ... ...
    }
    

    where all the rest parameters remain the same as in Phase 3.

    Run the following command in the same directory of your cumulus_inputs.json file:

    alto run -m cumulus/cumulus -w ws-lab/ws-01 --bucket-folder my-dir/results -i cumulus_inputs.json
    

Examples using Terra to perform single-cell sequencing analysis are provided here. Please click the topics on the left panel under title “Examples” to explore.

Extract gene-count matrices from plated-based SMART-Seq2 data

Run SMART-Seq2 Workflow

Follow the steps below to extract gene-count matrices from SMART-Seq2 data on Terra. This WDL aligns reads using STAR, HISAT2, or Bowtie 2 and estimates expression levels using RSEM.

  1. Copy your sequencing output to your workspace bucket using gsutil in your unix terminal.

    You can obtain your bucket URL in the dashboard tab of your Terra workspace under the information panel.

    _images/google_bucket_link.png

    Note: Broad users need to be on an UGER node (not a login node) in order to use the -m flag

    Request an UGER node:

    reuse UGER
    qrsh -q interactive -l h_vmem=4g -pe smp 8 -binding linear:8 -P regevlab
    

    The above command requests an interactive node with 4G memory per thread and 8 threads. Feel free to change the memory, thread, and project parameters.

    Once you’re connected to an UGER node, you can make gsutil available by running:

    reuse Google-Cloud-SDK
    

    Use gsutil cp [OPTION]... src_url dst_url to copy data to your workspace bucket. For example, the following command copies the directory at /foo/bar/nextseq/Data/VK18WBC6Z4 to a Google bucket:

    gsutil -m cp -r /foo/bar/nextseq/Data/VK18WBC6Z4 gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4
    

    -m means copy in parallel, -r means copy the directory recursively.

  2. Create a sample sheet.

    Please note that the columns in the CSV can be in any order, but that the column names must match the recognized headings.

    The sample sheet provides metadata for each cell:

    Column Description
    Cell Cell name.
    Plate Plate name. Cells with the same plate name are from the same plate.
    Read1 Location of the FASTQ file for read1 in the cloud (gsurl).
    Read2 (Optional). Location of the FASTQ file for read2 in the cloud (gsurl). This field can be skipped for single-end reads.

    Example:

    Cell,Plate,Read1,Read2
    cell-1,plate-1,gs://fc-e0000000-0000-0000-0000-000000000000/smartseq2/cell-1_L001_R1_001.fastq.gz,gs://fc-e0000000-0000-0000-0000-000000000000/smartseq2/cell-1_L001_R2_001.fastq.gz
    cell-2,plate-1,gs://fc-e0000000-0000-0000-0000-000000000000/smartseq2/cell-2_L001_R1_001.fastq.gz,gs://fc-e0000000-0000-0000-0000-000000000000/smartseq2/cell-2_L001_R2_001.fastq.gz
    cell-3,plate-2,gs://fc-e0000000-0000-0000-0000-000000000000/smartseq2/cell-3_L001_R1_001.fastq.gz,
    cell-4,plate-2,gs://fc-e0000000-0000-0000-0000-000000000000/smartseq2/cell-4_L001_R1_001.fastq.gz,
    
  3. Upload your sample sheet to the workspace bucket.

    Example:

    gsutil cp /foo/bar/projects/sample_sheet.csv gs://fc-e0000000-0000-0000-0000-000000000000/
    
  4. Import smartseq2 workflow to your workspace.

    See the Terra documentation for adding a workflow. The smartseq2 workflow is under Broad Methods Repository with name “cumulus/smartseq2”.

    Moreover, in the workflow page, click Export to Workspace... button, and select the workspace to which you want to export smartseq2 workflow in the drop-down menu.

  5. In your workspace, open smartseq2 in WORKFLOWS tab. Select Run workflow with inputs defined by file paths as below

    _images/single_workflow.png

    and click SAVE button.

Inputs:

Please see the description of inputs below. Note that required inputs are shown in bold.

Name Description Example Default
input_csv_file Sample Sheet (contains Cell, Plate, Read1, Read2) “gs://fc-e0000000-0000-0000-0000-000000000000/sample_sheet.csv”  
output_directory Output directory “gs://fc-e0000000-0000-0000-0000-000000000000/smartseq2_output”  
reference

Reference transcriptome to align reads to. Acceptable values:

  • Pre-created genome references:
    • “GRCh38_ens93filt” for human, genome version is GRCh38, gene annotation is generated using human Ensembl 93 GTF according to cellranger mkgtf;
    • “GRCm38_ens93filt” for mouse, genome version is GRCm38, gene annotation is generated using mouse Ensembl 93 GTF according to cellranger mkgtf;
  • Create a custom genome reference using smartseq2_create_reference workflow, and specify its Google bucket URL here.
“GRCh38_ens93filt”, or
“gs://fc-e0000000-0000-0000-0000-000000000000/rsem_ref.tar.gz”
 
aligner Which aligner to use for read alignment. Options are “hisat2-hca”, “star” and “bowtie” “star” “hisat2-hca”
output_genome_bam Whether to output bam file with alignments mapped to genomic coordinates and annotated with their posterior probabilities. false false
normalize_tpm_by_sequencing_depth Whether to normalize TPM values by sequencing depth. true true
smartseq2_version SMART-Seq2 version to use. Versions available: 1.1.0. “1.1.0” “1.1.0”
docker_registry

Docker registry to use. Options:

  • “quay.io/cumulus” for images on Red Hat registry;
  • “cumulusprod” for backup images on Docker Hub.
“quay.io/cumulus” “quay.io/cumulus”
zones Google cloud zones “us-east1-d us-west1-a us-west1-b” “us-central1-a us-central1-b us-central1-c us-central1-f us-east1-b us-east1-c us-east1-d us-west1-a us-west1-b us-west1-c”
num_cpu Number of cpus to request for one node 4 4
memory Memory size string “3.60G” If aligner is bowtie2 or hisat2-hca, “3.6G”; otherwise “32G”
disk_space_multiplier Factor to multiply size of R1 and R2 by for RSEM Float 11
generate_count_matrix_disk_space Disk space for count matrix generation task in GB Integer 10
preemptible Number of preemptible tries 2 2

Outputs:
Name Type Description
output_count_matrix Array[String] A list of google bucket urls containing gene-count matrices, one per plate. Each gene-count matrix file has the suffix .dge.txt.gz.
output_qc_report Array[String] A list of google bucket urls containing simple quality control statistics, one per plate. Each file contains one line per cell and each line has three columns: Total reads, Alignment rate and Unique rate.
rsem_gene Array[Array[File]] A 2D array of RSEM gene expression estimation files.
rsem_gene Array[Array[File]] A 2D array of RSEM gene expression estimation files.
rsem_isoform Array[Array[File]] A 2D array of RSEM isoform expression estimation files.
rsem_trans_bam Array[Array[File]] A 2D array of RSEM transcriptomic BAM files.
rsem_genome_bam Array[Array[File]] A 2D array of RSEM genomic BAM files if output_genome_bam is true.
rsem_time Array[Array[File]] A 2D array of RSEM execution time log files.
aligner_log Array[Array[File]] A 2D array of Aligner log files.
rsem_cnt Array[Array[File]] A 2D array of RSEM count files.
rsem_model Array[Array[File]] A 2D array of RSEM model files.
rsem_theta Array[Array[File]] A 2D array of RSEM generated theta files.

This WDL generates one gene-count matrix per SMART-Seq2 plate. The gene-count matrix uses Drop-Seq format:

  • The first line starts with "Gene" and then gives cell barcodes separated by tabs.
  • Starting from the second line, each line describes one gene. The first item in the line is the gene name and the rest items are TPM-normalized count values of this gene for each cell.

The gene-count matrices can be fed directly into cumulus for downstream analysis.

TPM-normalized counts are calculated as follows:

  1. Estimate the gene expression levels in TPM using RSEM.
  2. Suppose c reads are achieved for one cell, then calculate TPM-normalized count for gene i as TPM_i / 1e6 * c.

TPM-normalized counts reflect both the relative expression levels and the cell sequencing depth.


Custom Genome

We also provide a way of generating user-customized Genome references for SMART-Seq2 workflow.

  1. Import smartseq2_create_reference workflow to your workspace.

    See the Terra documentation for adding a workflow. The smartseq2_create_reference workflow is under Broad Methods Repository with name “cumulus/smartseq2_create_reference”.

    Moreover, in the workflow page, click Export to Workflow... button, and select the workspace to which you want to export smartseq2_create_reference in the drop-down menu.

  2. In your workspace, open smartseq2_create_reference in WORKFLOWS tab. Select Run workflow with inputs defined by file paths as below

    _images/single_workflow.png

    and click SAVE button.

Inputs:

Please see the description of inputs below. Note that required inputs are shown in bold.

Name Description Type or Example Default
fasta Genome fasta file
File.
For example, “gs://fc-e0000000-0000-0000-0000-000000000000/Homo_sapiens.GRCh38.dna.primary_assembly.fa”
 
gtf GTF gene annotation file (e.g. Homo_sapiens.GRCh38.83.gtf)
File.
For example, “gs://fc-e0000000-0000-0000-0000-000000000000/Homo_sapiens.GRCh38.83.gtf”
 
output_directory Google bucket url for the output folder “gs://fc-e0000000-0000-0000-0000-000000000000/output_refs”  
genome Output reference genome name. Output reference is a gzipped tarball with name genome_aligner.tar.gz “GRCm38_ens97filt”  
aligner Build indices for which aligner, choices are hisat2-hca, star, or bowtie2. “hisat2-hca” “hisat2-hca”
smartseq2_version
SMART-Seq2 version to use.
Versions available: 1.1.0.
Versions obsoleted: 1.0.0.
“1.1.0” “1.1.0”
docker_registry

Docker registry to use. Options:

  • “quay.io/cumulus” for images on Red Hat registry;
  • “cumulusprod” for backup images on Docker Hub.
“quay.io/cumulus” “quay.io/cumulus”
zones Google cloud zones “us-central1-c” “us-central1-b”
cpu Number of CPUs Integer If aligner is bowtie2 or hisat2-hca, 8; otherwise 32
memory Memory size string String If aligner is bowtie2 or hisat2-hca, “7.2G”; otherwise “120G”
disk_space Disk space in GB Integer If aligner is bowtie2 or hisat2-hca, 40; otherwise 120
preemptible Number of preemptible tries Integer 2
Outputs
Name Type Description
output_reference File The custom Genome reference generated. Its default file name is genome_aligner.tar.gz.
monitoring_log File CPU and memory profiling log.

Bulk RNA-Seq

Run Bulk RNA-Seq Workflow

Follow the steps below to generate count matrices from bulk RNA-Seq data on Terra. This WDL estimates expression levels using RSEM.

  1. Copy your sequencing output to your workspace bucket using gsutil in your unix terminal.

    You can obtain your bucket URL in the dashboard tab of your Terra workspace under the information panel.

    _images/google_bucket_link.png

    Note: Broad users need to be on an UGER node (not a login node) in order to use the -m flag

    Request an UGER node:

    reuse UGER
    qrsh -q interactive -l h_vmem=4g -pe smp 8 -binding linear:8 -P regevlab
    

    The above command requests an interactive node with 4G memory per thread and 8 threads. Feel free to change the memory, thread, and project parameters.

    Once you’re connected to an UGER node, you can make gsutil available by running:

    reuse Google-Cloud-SDK
    

    Use gsutil cp [OPTION]... src_url dst_url to copy data to your workspace bucket. For example, the following command copies the directory at /foo/bar/nextseq/Data/VK18WBC6Z4 to a Google bucket:

    gsutil -m cp -r /foo/bar/nextseq/Data/VK18WBC6Z4 gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4
    

    -m means copy in parallel, -r means copy the directory recursively.

  2. Create a Terra data table

    Example:

    entity:sample_id  read1 read2
    sample-1  gs://fc-e0000000/data-1/sample1-1_L001_R1_001.fastq.gz    gs://fc-e0000000/data-1/sample-1_L001_R2_001.fastq.gz
    sample-2 gs://fc-e0000000/data-1/sample-2_L001_R1_001.fastq.gz  gs://fc-e0000000/data-1/sample-2_L001_R2_001.fastq.gz
    

    You are free to add more columns, but sample ids and URLs to fastq files are required.

  3. Upload your TSV file to your workspace. Open the DATA tab on your workspace. Then click the upload button on left TABLE panel, and select the TSV file above. When uploading is done, you’ll see a new data table with name “sample”:

  4. Import bulk_rna_seq workflow to your workspace. Then open bulk_rna_seq in the WORKFLOW tab. Select Run workflow(s) with inputs defined by data table, and choose sample from the drop-down menu.

Inputs:

Please see the description of important inputs below. Note that required inputs are in bold.

Name Description Default
sample_name Sample name  
read1 Array of URLs to read 1  
read2 Array of URLs to read 2  
reference
Reference to align reads to
  • Pre-created genome references:
    • “GRCh38_ens93filt” for human, genome version is GRCh38, gene annotation is generated using human Ensembl 93 GTF according to cellranger mkgtf;
    • “GRCm38_ens93filt” for mouse, genome version is GRCm38, gene annotation is generated using mouse Ensembl 93 GTF according to cellranger mkgtf;
  • Create a custom genome reference using smartseq2_create_reference workflow, and specify its Google bucket URL here.
 
aligner Which aligner to use for read alignment. Options are “hisat2-hca”, “star” and “bowtie” “star”
output_genome_bam Whether to output bam file with alignments mapped to genomic coordinates and annotated with their posterior probabilities. false

Outputs:
Name Description
rsem_gene RSEM gene expression estimation.
rsem_isoform RSEM isoform expression estimation.
rsem_trans_bam RSEM transcriptomic BAM.
rsem_genome_bam RSEM genomic BAM files if output_genome_bam is true.
rsem_time RSEM execution time log.
aligner_log Aligner log.
rsem_cnt RSEM count.
rsem_model RSEM model.
rsem_theta RSEM theta.

Drop-seq pipeline

This workflow follows the steps outlined in the Drop-seq alignment cookbook from the McCarroll lab , except the default STAR aligner flags are –limitOutSJcollapsed 1000000 –twopassMode Basic. Additionally the pipeline provides the option to generate count matrices using dropEst.

  1. Copy your sequencing output to your workspace bucket using gsutil in your unix terminal.

    You can obtain your bucket URL in the dashboard tab of your Terra workspace under the information panel.

    _images/google_bucket_link.png

    Note: Broad users need to be on an UGER node (not a login node) in order to use the -m flag

    Request an UGER node:

    reuse UGER
    qrsh -q interactive -l h_vmem=4g -pe smp 8 -binding linear:8 -P regevlab
    

    The above command requests an interactive node with 4G memory per thread and 8 threads. Feel free to change the memory, thread, and project parameters.

    Once you’re connected to an UGER node, you can make gsutil available by running:

    reuse Google-Cloud-SDK
    

    Use gsutil cp [OPTION]... src_url dst_url to copy data to your workspace bucket. For example, the following command copies the directory at /foo/bar/nextseq/Data/VK18WBC6Z4 to a Google bucket:

    gsutil -m cp -r /foo/bar/nextseq/Data/VK18WBC6Z4 gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4
    

    -m means copy in parallel, -r means copy the directory recursively.

  2. Non Broad Institute users that wish to run bcl2fastq must create a custom docker image.

    See bcl2fastq instructions.

  3. Create a sample sheet.

    Please note that the columns in the CSV must be in the order shown below and does not contain a header line. The sample sheet provides either the FASTQ files for each sample if you’ve already run bcl2fastq or a list of BCL directories if you’re starting from BCL directories. Please note that BCL directories must contain a valid bcl2fastq sample sheet (SampleSheet.csv):

    Column Description
    Name Sample name.
    Read1 Location of the FASTQ file for read1 in the cloud (gsurl).
    Read2 Location of the FASTQ file for read2 in the cloud (gsurl).

    Example using FASTQ input files:

    sample-1,gs://fc-e0000000-0000-0000-0000-000000000000/dropseq-1/sample1-1_L001_R1_001.fastq.gz,gs://fc-e0000000-0000-0000-0000-000000000000/dropseq-1/sample-1_L001_R2_001.fastq.gz
    sample-2,gs://fc-e0000000-0000-0000-0000-000000000000/dropseq-1/sample-2_L001_R1_001.fastq.gz,gs://fc-e0000000-0000-0000-0000-000000000000/dropseq-1/sample-2_L001_R2_001.fastq.gz
    sample-1,gs://fc-e0000000-0000-0000-0000-000000000000/dropseq-2/sample1-1_L001_R1_001.fastq.gz,gs://fc-e0000000-0000-0000-0000-000000000000/dropseq-2/sample-1_L001_R2_001.fastq.gz
    

    Note that in this example, sample-1 was sequenced across two flowcells.

    Example using BCL input directories:

    gs://fc-e0000000-0000-0000-0000-000000000000/flowcell-1
    gs://fc-e0000000-0000-0000-0000-000000000000/flowcell-2
    

    Note that the flow cell directory must contain a bcl2fastq sample sheet named SampleSheet.csv.

  4. Upload your sample sheet to the workspace bucket.

    Example:

    gsutil cp /foo/bar/projects/sample_sheet.csv gs://fc-e0000000-0000-0000-0000-000000000000/
    
  5. Import dropseq_workflow workflow to your workspace.

    See the Terra documentation for adding a workflow. The dropseq_workflow is under Broad Methods Repository with name “cumulus/dropseq_workflow”.

    Moreover, in the workflow page, click the Export to Workspace... button, and select the workspace you want to export dropseq_workflow workflow in the drop-down menu.

  6. In your workspace, open dropseq_workflow in WORKFLOWS tab. Select Run workflow with inputs defined by file paths as below

    _images/single_workflow.png

    and click the SAVE button.


Inputs

Please see the description of important inputs below.

Name Description
input_csv_file CSV file containing sample name, read1, and read2 or a list of BCL directories.
output_directory Pipeline output directory (gs URL e.g. “gs://fc-e0000000-0000-0000-0000-000000000000/dropseq_output”)
reference hg19, GRCh38, mm10, hg19_mm10, mmul_8.0.1 or a path to a custom reference JSON file
run_bcl2fastq Whether your sample sheet contains one BCL directory per line or one sample per line (default false)
run_dropseq_tools Whether to generate count matrixes using Drop-Seq tools from the McCarroll lab (default true)
run_dropest Whether to generate count matrixes using dropEst (default false)
cellular_barcode_whitelist Optional whitelist of known cellular barcodes
drop_seq_tools_force_cells If supplied, bypass the cell detection algorithm (the elbow method) and use this number of cells.
dropest_cells_max Maximal number of output cells
dropest_genes_min Minimal number of genes for cells after the merge procedure (default 100)
dropest_min_merge_fraction Threshold for the merge procedure (default 0.2)
dropest_max_cb_merge_edit_distance Max edit distance between barcodes (default 2)
dropest_max_umi_merge_edit_distance Max edit distance between UMIs (default 1)
dropest_min_genes_before_merge Minimal number of genes for cells before the merge procedure. Used mostly for optimization. (default 10)
dropest_merge_barcodes_precise Use precise merge strategy (can be slow), recommended to use when the list of real barcodes is not available (default true)
dropest_velocyto Save separate count matrices for exons, introns and exon/intron spanning reads (default true)
trim_sequence The sequence to look for at the start of reads for trimming (default “AAGCAGTGGTATCAACGCAGAGTGAATGGG”)
trim_num_bases How many bases at the beginning of the sequence must match before trimming occur (default 5)
umi_base_range The base location of the molecular barcode (default 13-20)
cellular_barcode_base_range The base location of the cell barcode (default 1-12)
star_flags Additional options to pass to STAR aligner

Please note that run_bcl2fastq must be set to true if you’re starting from BCL files instead of FASTQs.

Custom Genome JSON

If you’re reference is not one of the predefined choices, you can create a custom JSON file. Example:

{
        "refflat":        "gs://fc-e0000000-0000-0000-0000-000000000000/human_mouse/hg19_mm10_transgenes.refFlat",
        "genome_fasta":    "gs://fc-e0000000-0000-0000-0000-000000000000/human_mouse/hg19_mm10_transgenes.fasta",
        "star_genome":    "gs://fc-e0000000-0000-0000-0000-000000000000/human_mouse/STAR2_5_index_hg19_mm10.tar.gz",
        "gene_intervals":        "gs://fc-e0000000-0000-0000-0000-000000000000/human_mouse/hg19_mm10_transgenes.genes.intervals",
        "genome_dict":    "gs://fc-e0000000-0000-0000-0000-000000000000/human_mouse/hg19_mm10_transgenes.dict",
        "star_cpus": 32,
        "star_memory": "120G"
}

The fields star_cpus and star_memory are optional and are used as the default cpus and memory for running STAR with your genome.

Outputs

The pipeline outputs a list of google bucket urls containing one gene-count matrix per sample. Each gene-count matrix file produced by Drop-seq tools has the suffix ‘dge.txt.gz’, matrices produced by dropEst have the extension .rds.

Building a Custom Genome

The tool dropseq_bundle can be used to build a custom genome. Please see the description of important inputs below.

Name Description
fasta_file Array of fasta files. If more than one species, fasta and gtf files must be in the same order.
gtf_file Array of gtf files. If more than one species, fasta and gtf files must be in the same order.
genomeSAindexNbases Length (bases) of the SA pre-indexing string. Typically between 10 and 15. Longer strings will use much more memory, but allow faster searches. For small genomes, must be scaled down to min(14, log2(GenomeLength)/2 - 1)
dropseq_workflow Terra Release Notes

Version 11

  • Added fastq_to_sam_memory and trim_bam_memory workflow inputs

Version 10

  • Updated workflow to WDL version 1.0

Version 9

  • Changed input bcl2fastq_docker_registry from optional to required

Version 8

  • Added additional parameters for bcl2fastq

Version 7

  • Added support for multi-species genomes (Barnyard experiments)

Version 6

  • Added star_extra_disk_space and star_disk_space_multiplier workflow inputs to adjust disk space allocated for STAR alignment task.

Version 5

  • Split preprocessing steps into separate tasks (FastqToSam, TagBam, FilterBam, and TrimBam).

Version 4

  • Handle uncompressed fastq files as workflow input.
  • Added optional prepare_fastq_disk_space_multiplier input.

Version 3

  • Set default value for docker_registry input.

Version 2

  • Added docker_registry input.

Version 1

  • Renamed sccloud to cumulus
  • Added use_bases_mask option when running bcl2fastq

Version 18

  • Created a separate docker image for running bcl2fastq

Version 17

  • Fixed bug that ignored WDL input star_flags (thanks to Carly Ziegler for reporting)
  • Changed default value of star_flags to the empty string (Prior versions of the WDL incorrectly indicated that basic 2-pass mapping was done)

Version 16

  • Use cumulus dockerhub organization
  • Changed default dropEst version to 0.8.6

Version 15

  • Added drop_deq_tools_prep_bam_memory and drop_deq_tools_dge_memory options

Version 14

  • Fix for downloading files from user pays buckets

Version 13

  • Set GCLOUD_PROJECT_ID for user pays buckets

Version 12

  • Changed default dropEst memory from 52G to 104G

Version 11

  • Updated formula for computing disk size for dropseq_count

Version 10

  • Added option to specify merge_bam_alignment_memory and sort_bam_max_records_in_ram

Version 9

  • Updated default drop_seq_tools_version from 2.2.0 to 2.3.0

Version 8

  • Made additional options available for running dropEst

Version 7

  • Changed default dropEst memory from 104G to 52G

Version 6

  • Added option to run dropEst

Version 5

  • Specify full version for bcl2fastq (2.20.0.422-2 instead of 2.20.0.422)

Version 4

  • Fixed issue that prevented bcl2fastq from running

Version 3

  • Set default run_bcl2fastq to false
  • Create shortcuts for commonly used genomes

Version 2

  • Updated QC report

Version 1

  • Initial release
dropseq_bundle Terra Release Notes

Version 4

  • Added create_intervals_memory and extra_star_flags inputs

Version 3

  • Added extra disk space inputs
  • Fixed bug that prevented creating multi-genome bundles

Version 2

  • Added docker_registry input

Version 1

  • Renamed sccloud to cumulus

Version 1

  • Changed docker organization

Version 1

  • Initial release

bcl2fastq

Workflows

Workflows such as cellranger_workflow and dropseq_workflow provide the option of running bcl2fastq. We provide dockers containing bcl2fastq that are accessible only by members of the Broad Institute. Non-Broad Institute members will have to provide their own docker images. Please note that if you’re a Broad Institute member and are not able to pull the docker image, please check https://app.terra.bio/#groups to see that you’re a member of the all_broad_users group. If not, please contact Terra support and ask to be added to the all_broad_users@firecloud.org group.

Docker

Read this tutorial if you are new to Docker.

Then for a Debian based docker (e.g. continuumio/miniconda3), create the Dockerfile as follows:

RUN apt-get update && apt-get install --no-install-recommends -y alien unzip
ADD bcl2fastq2-v2-20-0-linux-x86-64.zip /software/
RUN unzip -d /software/ /software/bcl2fastq2-v2-20-0-linux-x86-64.zip && alien -i /software/bcl2fastq2-v2.20.0.422-Linux-x86_64.rpm && rm /software/bcl2fastq2-v2*

Next, download bcl2fastq from the Illumina website, which requires registration. Choose the Linux rpm file format and download bcl2fastq2-v2-20-0-linux-x86-64.zip to the same directory as your Dockerfile.

You can host your private docker images in the Google Container Registry.

Example

In this example we create a docker image for running cellranger mkfastq version 3.0.2.

  1. Create a GCP project or reuse an existing project.

  2. Enable the Google Container Registry

  3. Clone the cumulus repository:

    git clone https://github.com/klarman-cell-observatory/cumulus.git
    
  4. Add the lines to cumulus/docker/cellranger/3.0.2/Dockerfile to include bcl2fastq (see Docker).

  5. Ensure you have Docker installed

  6. Download cellranger from https://support.10xgenomics.com/single-cell-gene-expression/software/downloads/3.0

  7. Build, tag, and push the docker. Remember to replace PROJECT_ID with your GCP project id:

    cd cumulus/docker/cellranger/3.0.2/
    docker build -t cellranger-3.0.2 .
    docker tag cellranger-3.0.2 gcr.io/PROJECT_ID/cellranger:3.0.2
    gcr.io/PROJECT_ID/cellranger:3.0.2
    
  8. Import cellranger_workflow workflow to your workspace (see cellranger_workflow steps), and enter your docker registry URL (in this example, "gcr.io/PROJECT_ID/") in cellranger_mkfastq_docker_registry field of cellranger_workflow inputs.

Cell Ranger alternatives to generate gene-count matrices for 10X data

This count workflow generates gene-count matrices from 10X FASTQ data using alternative methods other than Cell Ranger.

Prepare input data and import workflow

1. Run cellranger_workflow to generate FASTQ data

You can skip this step if your data are already in FASTQ format.

Otherwise, you need to first run cellranger_workflow to generate FASTQ files from BCL raw data for each sample. Please follow cellranger_workflow manual.

Notice that you should set run_mkfastq to true to get FASTQ output. You can also set run_count to false if you want to skip Cell Ranger count, and only use the result from count workflow.

For Non-Broad users, you’ll need to build your own docker for bcl2fastq step. Instructions are here.

2. Import count

Import count workflow to your workspace.

See the Terra documentation for adding a workflow. The count workflow is under Broad Methods Repository with name “cumulus/count”.

Moreover, in the workflow page, click the Export to Workspace... button, and select the workspace to which you want to export count workflow in the drop-down menu.

3. Prepare a sample sheet

3.1 Sample sheet format:

The sample sheet for count workflow should be in TSV format, i.e. columns are seperated by tabs not commas. Please note that the columns in the TSV can be in any order, but that the column names must match the recognized headings.

The sample sheet describes how to identify flowcells and generate channel-specific count matrices.

A brief description of the sample sheet format is listed below (required column headers are shown in bold).

Column Description
Sample Contains sample names. Each 10x channel should have a unique sample name.
Flowcells Indicates the Google bucket URLs of folder(s) holding FASTQ files of this sample.

The sample sheet supports sequencing the same 10x channel across multiple flowcells. If a sample is sequenced across multiple flowcells, simply list all of its flowcells in a comma-seperated way. In the following example, we have 2 samples sequenced in two flowcells.

Example:

Sample  Flowcells
sample_1        gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4/sample_1_fastqs,gs://fc-e0000000-0000-0000-0000-000000000000/VK10WBC9Z2/sample_1_fastqs
sample_2        gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4/sample_2_fastqs

Moreover, if one flowcell of a sample contains multiple FASTQ files for each read, i.e. sequences from multiple lanes, you should keep your sample sheet as the same, and count workflow will automatically merge lanes altogether for the sample before performing counting.

3.2 Upload your sample sheet to the workspace bucket:

Use gsutil (you already have it if you’ve installed Google cloud SDK) in your unix terminal to upload your sample sheet to workspace bucket.

Example:

gsutil cp /foo/bar/projects/sample_sheet.tsv gs://fc-e0000000-0000-0000-0000-000000000000/
4. Launch analysis

In your workspace, open count in WORKFLOWS tab. Select the desired snapshot version (e.g. latest). Select Process single workflow from files as below

_images/single_workflow.png

and click SAVE button. Select Use call caching and click INPUTS. Then fill in appropriate values in the Attribute column. Alternative, you can upload a JSON file to configure input by clicking Drag or click to upload json.

Once INPUTS are appropriated filled, click RUN ANALYSIS and then click LAUNCH.


Workflow inputs

Below are inputs for count workflow. Notice that required inputs are in bold.

Name Description Example Default
input_tsv_file Input TSV sample sheet describing metadata of each sample. “gs://fc-e0000000-0000-0000-0000-000000000000/sample_sheet.tsv”  
genome Genome reference name. Current support: GRCh38, mm10. “GRCh38”  
chemistry 10X genomics’ chemistry name. Current support: “tenX_v3” (for V3 chemistry), “tenX_v2” (for V2 chemistry), “dropseq” (for Drop-Seq). “tenX_v3”  
output_directory GS URL of output directory. “gs://fc-e0000000-0000-0000-0000-000000000000/count_result”  
run_count If you want to run count tools to generate gene-count matrices. true true
count_tool

Count tool to generate result. Options:

“StarSolo” “StarSolo”
docker_registry

Docker registry to use. Notice that docker image for Bustools is seperate.

  • “quay.io/cumulus” for images on Red Hat registry;
  • “cumulusprod” for backup images on Docker Hub.
“quay.io/cumulus” “quay.io/cumulus”
config_version Version of config docker image to use. This docker is used for parsing the input sample sheet for downstream execution. Available options: 0.2, 0.1. “0.2” “0.2”
zones Google cloud zones to consider for execution. “us-east1-d us-west1-a us-west1-b” “us-central1-a us-central1-b us-central1-c us-central1-f us-east1-b us-east1-c us-east1-d us-west1-a us-west1-b us-west1-c”
num_cpu
Number of CPUs to request for count per channel.
Notice that when use Optimus for count, this input only affects steps of copying files. Optimus uses CPUs due to its own strategy.
32 32
disk_space
Disk space in GB needed for count per channel.
Notice that when use Optimus for count, this input only affects steps of copying files. Optimus uses disk space due to its own strategy.
500 500
memory
Memory size in GB needed for count per channel.
Notice that when use Optimus for count, this input only affects steps of copying files. Optimus uses memory size due to its own strategy.
120 120
preemptible
Number of maximum preemptible tries allowed.
Notice that when use Optimus for count, this input only affects steps of copying files. Optimus uses preemptible tries due to its own strategy.
2 2
merge_fastq_memory Memory size in GB needed for merge fastq per channel. 32 32
starsolo_star_version
STAR version to use. Currently only support “2.7.3a”.
This input only works when setting count_tool to StarSolo.
“2.7.3a” “2.7.3a”
alevin_version
Salmon version to use. Currently only support “1.1”.
This input only works when setting count_tool to Alevin.
“1.1” “1.1”
bustools_output_loom
If BUSTools generates gene-count matrices in loom format.
This input only works when setting count_tool to Bustools.
false false
bustools_output_h5ad
If BUSTools generates gene-count matrices in h5ad format.
This input only works when setting count_tool to Bustools.
false false
bustools_docker
Docker image used for Kallisto BUSTools count.
This input only works when setting count_tool to Bustools.
“shaleklab/kallisto-bustools” “shaleklab/kallisto-bustools”
bustools_version
kb version to use. Currently only support “0.24.4”.
This input only works when setting count_tool to Bustools.
“0.24.4” “0.24.4”
optimus_output_loom
If Optimus generates gene-count matrices in loom format.
This input only works when setting count_tool to Optimus.
true true

Workflow outputs

See the table below for count workflow outputs.

Name Type Description
output_folder String Google Bucket URL of output directory. Within it, each folder is for one sample in the input sample sheet.

Topic modeling

Prepare input data

Follow the steps below to run topic_modeling on Terra.

  1. Prepare your count matrix. Cumulus currently supports the following formats: ‘zarr’, ‘h5ad’, ‘loom’, ‘10x’, ‘mtx’, ‘csv’, ‘tsv’ and ‘fcs’ (for flow/mass cytometry data) formats

  2. Upload your count matrix to the workspace.

    Example:

    gsutil cp /foo/bar/projects/dataset.h5ad gs://fc-e0000000-0000-0000-0000-000000000000/
    

    where /foo/bar/projects/dataset.h5ad is the path to your dataset on your local machine, and gs://fc-e0000000-0000-0000-0000-000000000000/ is the Google bucket destination.

  3. Import topic_modeling workflow to your workspace.

    See the Terra documentation for adding a workflow. The cumulus workflow is under Broad Methods Repository with name “cumulus/topic_modeling”.

    Moreover, in the workflow page, click the Export to Workspace... button, and select the workspace to which you want to export topic_modeling workflow in the drop-down menu.

  4. In your workspace, open topic_modeling in WORKFLOWS tab. Select Run workflow with inputs defined by file paths as below

    _images/single_workflow.png

    and click the SAVE button.

Workflow input

Inputs for the topic_modeling workflow are described below. Required inputs are in bold.

Name Description Example Default
input_file Google bucket URL of the input count matrix. “gs://fc-e0000000-0000-0000-0000-000000000000/my_dataset.h5ad”  
number_of_topics Array of number of topics. [10,15,20]  
prefix_exclude Comma separated list of features to exclude that start with prefix. “mt-,Rpl,Rps” “mt-,Rpl,Rps”
min_percent_expressed Exclude features expressed below min_percent. 2  
max_percent_expressed Exclude features expressed below min_percent. 98  
random_number_seed Random number seed for reproducibility. 0 0

Workflow output

Name Type Description
coherence_plot File Plot of coherence scores vs. number of topics
perplexity_plot File Plot of perplexity values vs. number of topics
cell_scores Array[File] Topic by cells (one file for each topic number)
feature_topics Array[File] Topic by features (one file for each topic number)
report Array[File] HTML visualization report (one file for each topic number)
stats Array[File] Computed coherence and perplexity (one file for each topic number)
model Array[File] Serialized LDA model (one file for each topic number)
corpus File Serialized corpus
dictionary File Serialized dictionary

Contributions

We welcome contributions to our repositories that make up the Cumulus ecosystem:

In addition to the Cumulus team, we would like to sincerely thank the following contributors:

Name Note
Kirk Gosik Assistance with topic modeling workflow

Contact us

If you have any questions related to Cumulus, please feel free to contact us via Cumulus Support Google Group.