Run Cell Ranger tools using cellranger_workflow¶
cellranger_workflow
wraps Cell Ranger to process single-cell/nucleus RNA-seq, single-cell ATAC-seq and single-cell immune profiling data, and supports feature barcoding (cell/nucleus hashing, CITE-seq, Perturb-seq). It also provide routines to build cellranger references.
A general step-by-step instruction¶
1. Import cellranger_workflow
¶
Import cellranger_workflow workflow to your workspace.
See the Terra documentation for adding a workflow. The cellranger_workflow workflow is under
Broad Methods Repository
with name “cumulus/cellranger_workflow”.Moreover, in the workflow page, click the
Export to Workspace...
button, and select the workspace to which you want to export cellranger_workflow workflow in the drop-down menu.
2. Upload sequencing data to Google bucket¶
Copy your sequencing output to your workspace bucket using gsutil (you already have it if you’ve installed Google cloud SDK) in your unix terminal.
You can obtain your bucket URL in the dashboard tab of your Terra workspace under the information panel.
Use
gsutil cp [OPTION]... src_url dst_url
to copy data to your workspace bucket. For example, the following command copies the directory at /foo/bar/nextseq/Data/VK18WBC6Z4 to a Google bucket:gsutil -m cp -r /foo/bar/nextseq/Data/VK18WBC6Z4 gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4
-m
means copy in parallel,-r
means copy the directory recursively, andgs://fc-e0000000-0000-0000-0000-000000000000
should be replaced by your own workspace Google bucket URL.Note 1: If input is a folder of BCL files, users do not need to upload the whole folder to the Google bucket. Instead, they only need to upload the following files:
RunInfo.xml RTAComplete.txt runParameters.xml Data/Intensities/s.locs Data/Intensities/BaseCallsIf data are generated using MiSeq or NextSeq, the location files are inside lane subfloders
L001
underData/Intensities/
. In addition, if users’ data only come from a subset of lanes (e.g.L001
andL002
), users only need to upload lane subfolders from the subset (e.g.Data/Intensities/BaseCalls/L001, Data/Intensities/BaseCalls/L002
andData/Intensities/L001, Data/Intensities/L002
if sequencer is MiSeq or NextSeq).Users can submit jobs through command line interface (CLI) using
altocumulus
, which will smartly upload BCL folders according to the above rules.Note 2: Broad users need to be on an UGER node (not a login node) in order to use the
-m
flagRequest an UGER node:
reuse UGER qrsh -q interactive -l h_vmem=4g -pe smp 8 -binding linear:8 -P regevlabThe above command requests an interactive node with 4G memory per thread and 8 threads. Feel free to change the memory, thread, and project parameters.
Once you’re connected to an UGER node, you can make gsutil available by running:
reuse Google-Cloud-SDK
3. Prepare a sample sheet¶
3.1 Sample sheet format:
Please note that the columns in the CSV can be in any order, but that the column names must match the recognized headings.
The sample sheet describes how to demultiplex flowcells and generate channel-specific count matrices. Note that Sample, Lane, and Index columns are defined exactly the same as in 10x’s simple CSV layout file.
A brief description of the sample sheet format is listed below (required column headers are shown in bold).
Column Description Sample Contains sample names. Each 10x channel should have a unique sample name. Reference Provides the reference genome used by Cell Ranger for each 10x channel.The elements in the reference column can be either Google bucket URLs to reference tarballs or keywords such as GRCh38_v3.0.0.A full list of available keywords is included in each of the following data type sections (e.g. sc/snRNA-seq) below.Flowcell Indicates the Google bucket URLs of uploaded BCL folders.If starts with FASTQ files, this should be Google bucekt URLs of uploaded FASTQ folders.The FASTQ folders should contain one subfolder for each sample in the flowcell with the sample name as the subfolder name.Each subfolder contains FASTQ files for that sample.Lane Tells which lanes the sample was pooled into.Can be either single lane (e.g. 8) or a range (e.g. 7-8) or all (e.g. *).Index Sample index (e.g. SI-GA-A12). Chemistry Describes the 10x chemistry used for the sample. This column is optional. DataType Describes the data type of the sample — rna, vdj, adt, or crispr.rna refers to gene expression data (cellranger count),vdj refers to V(D)J data (cellranger vdj),adt refers to antibody tag data, which can be either CITE-Seq, cell-hashing, or nucleus-hashing,crispr refers to Perturb-seq guide tag data,atac refers to scATAC-Seq data (cellranger-atac count).This column is optional and the default data type is rna.FeatureBarcodeFile Google bucket urls pointing to feature barcode files for adt and crispr data.Features can be either antibody for CITE-Seq, cell-hashing, nucleus-hashing or gRNA for Perburb-seq.This column is optional provided no adt or crispr data are in the sample sheet.The sample sheet supports sequencing the same 10x channels across multiple flowcells. If a sample is sequenced across multiple flowcells, simply list it in multiple rows, with one flowcell per row. In the following example, we have 4 samples sequenced in two flowcells.
Example:
Sample,Reference,Flowcell,Lane,Index,Chemistry,DataType,FeatureBarcodeFile sample_1,GRCh38_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,1-2,SI-GA-A8,threeprime,rna sample_2,GRCh38_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,3-4,SI-GA-B8,SC3Pv3,rna sample_3,mm10_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,5-6,SI-GA-C8,fiveprime,rna sample_4,mm10_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,7-8,SI-GA-D8,fiveprime,rna sample_1,GRCh38_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK10WBC9Z2,1-2,SI-GA-A8,threeprime,rna sample_2,GRCh38_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK10WBC9Z2,3-4,SI-GA-B8,SC3Pv3,rna sample_3,mm10_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK10WBC9Z2,5-6,SI-GA-C8,fiveprime,rna sample_4,mm10_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK10WBC9Z2,7-8,SI-GA-D8,fiveprime,rna3.2 Upload your sample sheet to the workspace bucket:
Example:
gsutil cp /foo/bar/projects/sample_sheet.csv gs://fc-e0000000-0000-0000-0000-000000000000/
4. Launch analysis¶
In your workspace, open
cellranger_workflow
inWORKFLOWS
tab. Select the desired snapshot version (e.g. latest). SelectRun workflow with inputs defined by file paths
as belowand click
SAVE
button. SelectUse call caching
and clickINPUTS
. Then fill in appropriate values in theAttribute
column. Alternative, you can upload a JSON file to configure input by clickingDrag or click to upload json
.Once INPUTS are appropriated filled, click
RUN ANALYSIS
and then clickLAUNCH
.
5. Notice: run cellranger mkfastq
if you are non Broad Institute users¶
Non Broad Institute users that wish to run
cellranger mkfastq
must create a custom docker image that containsbcl2fastq
.See bcl2fastq instructions.
6. Do not run cellranger mkfastq
¶
Sometimes, users might want to perform demultiplexing locally and only run the count part on the cloud. This section describes how to only run the count part via cellranger_workflow
.
Copy your FASTQ files to the workspace using gsutil in your unix terminal.
You should upload folders of FASTQ files. The uploaded folder (for one flowcell) should contain one subfolder for each sample belong to the this flowcell. In addition, the subfolder name should be the sample name. Each subfolder contains FASTQ files for that sample.
Example:
gsutil -m cp -r /foo/bar/fastq_path/K18WBC6Z4 gs://fc-e0000000-0000-0000-0000-000000000000/K18WBC6Z4_fastq
Create a sample sheet.
Flowcell column should list Google bucket URLs of the FASTQ folders for flowcells.
Example:
Sample,Reference,Flowcell sample_1,GRCh38_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/K18WBC6Z4_fastq
Set optional input
run_mkfastq
tofalse
.
Single-cell and single-nucleus RNA-seq¶
To process sc/snRNA-seq data, follow the specific instructions below.
Sample sheet¶
Reference column.
Pre-built scRNA-seq references are summarized below.
Keyword Description GRCh38_v3.0.0 Human GRCh38, cellranger reference 3.0.0, Ensembl v93 gene annotation hg19_v3.0.0 Human hg19, cellranger reference 3.0.0, Ensembl v87 gene annotation mm10_v3.0.0 Mouse mm10, cellranger reference 3.0.0, Ensembl v93 gene annotation GRCh38_and_mm10_v3.1.0 Human (GRCh38) and mouse (mm10), cellranger references 3.1.0, Ensembl v93 gene annotations for both human and mouse GRCh38_v1.2.0 or GRCh38 Human GRCh38, cellranger reference 1.2.0, Ensembl v84 gene annotation hg19_v1.2.0 or hg19 Human hg19, cellranger reference 1.2.0, Ensembl v82 gene annotation mm10_v1.2.0 or mm10 Mouse mm10, cellranger reference 1.2.0, Ensembl v84 gene annotation GRCh38_and_mm10_v1.2.0 or GRCh38_and_mm10 Human and mouse, built from GRCh38 and mm10 cellranger references, Ensembl v84 gene annotations are used Pre-built snRNA-seq references are summarized below.
Keyword Description GRCh38_premrna_v1.2.0 or GRCh38_premrna Human, introns included, built from GRCh38 cellranger reference 1.2.0, Ensembl v84 gene annotation, treating annotated transcripts as exons mm10_premrna_v1.2.0 or mm10_premrna Mouse, introns included, built from mm10 cellranger reference 1.2.0, Ensembl v84 gene annotation, treating annotated transcripts as exons GRCh38_premrna_and_mm10_premrna_v1.2.0 or GRCh38_premrna_and_mm10_premrna Human and mouse, introns included, built from GRCh38_premrna_v1.2.0 and mm10_premrna_v1.2.0 Index column.
Put 10x single cell 3’ sample index set names (e.g. SI-GA-A12) here.
Chemistry column.
According to cellranger count’s documentation, chemistry can be
Chemistry Explanation auto autodetection (default). If the index read has extra bases besides cell barcode and UMI, autodetection might fail. In this case, please specify the chemistry threeprime Single Cell 3′ fiveprime Single Cell 5′ SC3Pv1 Single Cell 3′ v1 SC3Pv2 Single Cell 3′ v2 SC3Pv3 Single Cell 3′ v3. You should set cellranger version input parameter to >= 3.0.2 SC5P-PE Single Cell 5′ paired-end (both R1 and R2 are used for alignment) SC5P-R2 Single Cell 5′ R2-only (where only R2 is used for alignment) DataType column.
This column is optional with a default rna. If you want to put a value, put rna here.
FetureBarcodeFile column.
Leave it blank for scRNA-seq and snRNA-seq.
Example:
Sample,Reference,Flowcell,Lane,Index,Chemistry,DataType,FeatureBarcodeFile sample_1,GRCh38_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,1-2,SI-GA-A8,threeprime,rna sample_2,GRCh38_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,3-4,SI-GA-B8,SC3Pv3,rna sample_3,mm10_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,5-6,SI-GA-C8,fiveprime,rna sample_4,mm10_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,7-8,SI-GA-D8,fiveprime,rna sample_1,GRCh38_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK10WBC9Z2,1-2,SI-GA-A8,threeprime,rna sample_2,GRCh38_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK10WBC9Z2,3-4,SI-GA-B8,SC3Pv3,rna sample_3,mm10_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK10WBC9Z2,5-6,SI-GA-C8,fiveprime,rna sample_4,mm10_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK10WBC9Z2,7-8,SI-GA-D8,fiveprime,rna
Workflow input¶
For sc/snRNA-seq data, cellranger_workflow
takes Illumina outputs as input and runs cellranger mkfastq
and cellranger count
. Revalant workflow inputs are described below, with required inputs highlighted in bold.
Name Description Example Default input_csv_file Sample Sheet (contains Sample, Reference, Flowcell, Lane, Index as required and Chemistry, DataType, FeatureBarcodeFile as optional) “gs://fc-e0000000-0000-0000-0000-000000000000/sample_sheet.csv” output_directory Output directory “gs://fc-e0000000-0000-0000-0000-000000000000/cellranger_output” Results are written to $output_directory/$bcl_directory_fastqs/fastq_path/ and will overwrite any existing files at this location. run_mkfastq If you want to run cellranger mkfastq
true true run_count If you want to run cellranger count
true true delete_input_directory If delete BCL directories after demux. If false, you should delete this folder yourself so as to not incur storage charges false false force_cells Force pipeline to use this number of cells, bypassing the cell detection algorithm, mutually exclusive with expect_cells 6000 expect_cells Expected number of recovered cells. Mutually exclusive with force_cells 3000 secondary Perform Cell Ranger secondary analysis (dimensionality reduction, clustering, etc.) false false cellranger_version cellranger version, could be 3.1.0, 3.0.2, or 2.2.0 “3.1.0” “3.1.0” docker_registry Docker registry to use for cellranger_workflow. Options:
- “cumulusprod” for Docker Hub images;
- “quay.io/cumulus” for backup images on Red Hat registry.
“cumulusprod” “cumulusprod” cellranger_mkfastq_docker_registry Docker registry to use for cellranger mkfastq
. Default is the registry to which only Broad users have access. See bcl2fastq for making your own registry.“gcr.io/broad-cumulus” “gcr.io/broad-cumulus” zones Google cloud zones “us-central1-a us-west1-a” “us-central1-a us-central1-b us-central1-c us-central1-f us-east1-b us-east1-c us-east1-d us-west1-a us-west1-b us-west1-c” num_cpu Number of cpus to request for one node for cellranger mkfastq and cellranger count 32 32 memory Memory size string for cellranger mkfastq and cellranger count “120G” “120G” mkfastq_disk_space Optional disk space in GB for mkfastq 1500 1500 count_disk_space Disk space in GB needed for cellranger count 500 500 preemptible Number of preemptible tries 2 2
Workflow output¶
See the table below for important sc/snRNA-seq outputs.
Name | Type | Description |
---|---|---|
output_fastqs_directory | Array[String] | A list of google bucket urls containing FASTQ files, one url per flowcell. |
output_count_directory | Array[String] | A list of google bucket urls containing count matrices, one url per sample. |
metrics_summaries | File | A excel spreadsheet containing QCs for each sample. |
output_web_summary | Array[File] | A list of htmls visualizing QCs for each sample (cellranger count output). |
count_matrix | String | gs url for a template count_matrix.csv to run Cumulus. |
Feature barcoding assays (cell & nucleus hashing, CITE-seq and Perturb-seq)¶
cellranger_workflow
can extract feature-barcode count matrices in CSV format for feature barcoding assays such as cell and nucleus hashing, CITE-seq, and Perturb-seq. For cell and nucleus hashing as well as CITE-seq, the feature refers to antibody. For Perturb-seq, the feature refers to guide RNA. Please follow the instructions below to configure cellranger_workflow
.
Prepare feature barcode files¶
Prepare a CSV file with the following format: feature_barcode,feature_name. See below for an example:
TTCCTGCCATTACTA,sample_1 CCGTACCTCATTGTT,sample_2 GGTAGATGTCCTCAG,sample_3 TGGTGTCATTCTTGA,sample_4The above file describes a cell hashing application with 4 samples.
Then upload it to your google bucket:
gsutil antibody_index.csv gs://fc-e0000000-0000-0000-0000-000000000000/antibody_index.csv
Sample sheet¶
Reference column.
This column is not used for extracting feature-barcode count matrix. To be consistent, please put the reference for the associated scRNA-seq assay here.
Index column.
The ADT/HTO index can be either Illumina index primer sequence (e.g.
ATTACTCG
, also known asD701
), or 10x single cell 3’ sample index set names (e.g. SI-GA-A12).Note 1: All ADT/HTO index sequences (including 10x’s) should have the same length (8 bases). If one index sequence is shorter (e.g. ATCACG), pad it with P7 sequence (e.g. ATCACGAT).
Note 2: It is users’ responsibility to avoid index collision between 10x genomics’ RNA indexes (e.g. SI-GA-A8) and Illumina index sequences for used here (e.g.
ATTACTCG
).Note 3: For NextSeq runs, please reverse complement the ADT/HTO index primer sequence (e.g. use reverse complement
CGAGTAAT
instead ofATTACTCG
).Chemistry column.
The following keywords are accepted for Chemistry column:
Chemistry Explanation SC3Pv3 Single Cell 3′ v3 (default). SC3Pv2 Single Cell 3′ v2 fiveprime Single Cell 5′ SC5P-PE Single Cell 5′ paired-end (both R1 and R2 are used for alignment) SC5P-R2 Single Cell 5′ R2-only (where only R2 is used for alignment) DataType column.
Put adt here if the assay is CITE-seq, cell or nucleus hashing. Put crispr here if Perturb-seq.
FetureBarcodeFile column.
Put Google Bucket URL of the feature barcode file here.
Example:
Sample,Reference,Flowcell,Lane,Index,Chemistry,DataType,FeatureBarcodeFile sample_1_rna,GRCh38_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,1-2,SI-GA-A8,threeprime,rna sample_1_adt,GRCh38_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,1-2,ATTACTCG,threeprime,adt,gs://fc-e0000000-0000-0000-0000-000000000000/antibody_index.csv sample_2_adt,GRCh38_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,3-4,TCCGGAGA,SC3Pv3,adt,gs://fc-e0000000-0000-0000-0000-000000000000/antibody_index.csv sample_3_crispr,GRCh38_v3.0.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK18WBC6Z4,5-6,CGCTCATT,SC3Pv3,crispr,gs://fc-e0000000-0000-0000-0000-000000000000/crispr_index.csv
In the sample sheet above, despite the header row,
- First row describes the normal 3’ RNA assay;
- Second row describes its associated antibody tag data, which can from either a CITE-seq, cell hashing, or nucleus hashing experiment.
- Third row describes another tag data, which is in 10x genomics’ V3 chemistry. For tag and crispr data, it is important to explicitly state the chemistry (e.g.
SC3Pv3
).- Last row describes one gRNA guide data for Perturb-seq (see
crispr
in DataType field).
Workflow input¶
For feature barcoding data, cellranger_workflow
takes Illumina outputs as input and runs cellranger mkfastq
and cumulus adt
. Revalant workflow inputs are described below, with required inputs highlighted in bold.
Name Description Example Default input_csv_file Sample Sheet (contains Sample, Reference, Flowcell, Lane, Index as required and Chemistry, DataType, FeatureBarcodeFile as optional) “gs://fc-e0000000-0000-0000-0000-000000000000/sample_sheet.csv” output_directory Output directory “gs://fc-e0000000-0000-0000-0000-000000000000/cellranger_output” run_mkfastq If you want to run cellranger mkfastq
true true delete_input_directory If delete BCL directories after demux. If false, you should delete this folder yourself so as to not incur storage charges false false scaffold_sequence Scaffold sequence in sgRNA for Purturb-seq, only used for crispr data type. If it is “”, we assume guide barcode starts at position 0 of read 2 “GTTTAAGAGCTAAGCTGGAA” “” max_mismatch Maximum hamming distance in feature barcodes for the adt task 3 3 min_read_ratio Minimum read count ratio (non-inclusive) to justify a feature given a cell barcode and feature combination, only used for the adt task and crispr data type 0.1 0.1 cellranger_version cellranger version, could be 3.1.0, 3.0.2, 2.2.0 “3.1.0” “3.1.0” cumulus_feature_barcoding_version Cumulus_feature_barcoding version for extracting feature barcode matrix. Version available: 0.2.0. “0.2.0” “0.2.0” docker_registry Docker registry to use for cellranger_workflow. Options:
- “cumulusprod” for Docker Hub images;
- “quay.io/cumulus” for backup images on Red Hat registry.
“cumulusprod” “cumulusprod” mkfastq_docker_registry Docker registry to use for cellranger mkfastq
. Default is the registry to which only Broad users have access. See bcl2fastq for making your own registry.“gcr.io/broad-cumulus” “gcr.io/broad-cumulus” zones Google cloud zones “us-central1-a us-west1-a” “us-central1-a us-central1-b us-central1-c us-central1-f us-east1-b us-east1-c us-east1-d us-west1-a us-west1-b us-west1-c” num_cpu Number of cpus to request for one node for cellranger mkfastq 32 32 memory Memory size string for cellranger mkfastq “120G” “120G” feature_memory Optional memory string for extracting feature count matrix “32G” “32G” mkfastq_disk_space Optional disk space in GB for mkfastq 1500 1500 feature_disk_space Disk space in GB needed for extracting feature count matrix 100 100 preemptible Number of preemptible tries 2 2
Parameters used for feature count matrix extraction¶
If the chemistry is V2, 10x genomics v2 cell barcode white list will be used, a hamming distance of 1 is allowed for matching cell barcodes, and the UMI length is 10. If the chemistry is V3, 10x genomics v3 cell barcode white list will be used, a hamming distance of 0 is allowed for matching cell barcodes, and the UMI length is 12.
For Perturb-seq data, a small number of sgRNA protospace sequences will be sequenced ultra-deeply and we may have PCR chimeric reads. Therefore, we generate filtered feature count matrices as well in a data driven manner:
- First, plot the histogram of UMIs with certain number of read counts. The number of UMIs with
x
supporting reads decreases whenx
increases. We start fromx = 1
, and a valley between two peaks is detected if we findcount[x] < count[x + 1] < count[x + 2]
. We filter out all UMIs with< x
supporting reads since they are likely formed due to chimeric reads. - In addition, we also filter out barcode-feature-UMI combinations that have their read count ratio, which is defined as total reads supporting barcode-feature-UMI over total reads supporting barcode-UMI, no larger than
min_read_ratio
parameter set above.
Workflow outputs¶
See the table below for important outputs.
Name | Type | Description |
---|---|---|
output_fastqs_directory | Array[String] | A list of google bucket urls containing FASTQ files, one url per flowcell. |
output_count_directory | Array[String] | A list of google bucket urls containing feature-barcode count matrices, one url per sample. |
count_matrix | String | gs url for a template count_matrix.csv to run cumulus. |
In addition, For each antibody tag or crispr tag sample, a folder with the sample ID is generated under output_directory
. In the folder, two files — sample_id.csv
and sample_id.stat.csv.gz
— are generated.
sample_id.csv
is the feature count matrix. It has the following format. The first line describes the column names: Antibody/CRISPR,cell_barcode_1,cell_barcode_2,...,cell_barcode_n
. The following lines describe UMI counts for each feature barcode, with the following format: feature_name,umi_count_1,umi_count_2,...,umi_count_n
.
sample_id.stat.csv.gz
stores the gzipped sufficient statistics. It has the following format. The first line describes the column names: Barcode,UMI,Feature,Count
. The following lines describe the read counts for every barcode-umi-feature combination.
If data type is crispr
, three additional files, sample_id.umi_count.pdf
, sample_id.filt.csv
and sample_id.filt.stat.csv.gz
, are generated.
sample_id.umi_count.pdf
plots number of UMIs against UMI with certain number of reads and colors UMIs with high likelihood of being chimeric in blue and other UMIs in red. This plot is generated purely based on number of reads each UMI has.
sample_id.filt.csv
is the filtered feature count matrix. It has the same format as sample_id.csv
.
sample_id.filt.stat.csv.gz
is the filtered sufficient statistics. It has the same format as sample_id.stat.csv.gz
.
Single-cell ATAC-seq¶
To process scATAC-seq data, follow the specific instructions below.
Sample sheet¶
Reference column.
Pre-built scATAC-seq references are summarized below.
Keyword Description GRCh38_atac_v1.2.0 Human GRCh38, cellranger-atac reference 1.2.0 mm10_atac_v1.2.0 Mouse mm10, cellranger-atac reference 1.2.0 hg19_atac_v1.2.0 Human hg19, cellranger-atac reference 1.2.0 b37_atac_v1.2.0 Human b37 build, cellranger-atac reference 1.2.0 GRCh38_and_mm10_atac_v1.2.0 Human GRCh38 and mouse mm10, cellranger-atac reference 1.2.0 hg19_and_mm10_atac_v1.2.0 Human hg19 and mouse mm10, cellranger-atac reference 1.2.0 GRCh38_atac_v1.1.0 Human GRCh38, cellranger-atac reference 1.1.0 mm10_atac_v1.1.0 Mouse mm10, cellranger-atac reference 1.1.0 hg19_atac_v1.1.0 Human hg19, cellranger-atac reference 1.1.0 b37_atac_v1.1.0 Human b37 build, cellranger-atac reference 1.1.0 GRCh38_and_mm10_atac_v1.1.0 Human GRCh38 and mouse mm10, cellranger-atac reference 1.1.0 hg19_and_mm10_atac_v1.1.0 Human hg19 and mouse mm10, cellranger-atac reference 1.1.0 Index column.
Put 10x single cell ATAC sample index set names (e.g. SI-NA-B1) here.
Chemistry column.
This column is not used for scATAC-seq data. Put auto here as a placeholder if you decide to include the Chemistry column.
DataType column.
Set it to atac.
FetureBarcodeFile column.
Leave it blank for scATAC-seq.
Example:
Sample,Reference,Flowcell,Lane,Index,Chemistry,DataType sample_atac,GRCh38_atac_v1.1.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK10WBC9YB,*,SI-NA-A1,auto,atac
Workflow input¶
cellranger_workflow
takes Illumina outputs as input and runs cellranger-atac mkfastq
and cellranger-atac count
. Please see the description of inputs below. Note that required inputs are shown in bold.
Name | Description | Example | Default |
---|---|---|---|
input_csv_file | Sample Sheet (contains Sample, Reference, Flowcell, Lane, Index as required and Chemistry, DataType, FeatureBarcodeFile as optional) | “gs://fc-e0000000-0000-0000-0000-000000000000/sample_sheet.csv” | |
output_directory | Output directory | “gs://fc-e0000000-0000-0000-0000-000000000000/cellranger_output” | |
run_mkfastq | If you want to run cellranger-atac mkfastq |
true | true |
run_count | If you want to run cellranger-atac count |
true | true |
delete_input_directory | If delete BCL directories after demux. If false, you should delete this folder yourself so as to not incur storage charges | false | false |
force_cells | Force pipeline to use this number of cells, bypassing the cell detection algorithm | 6000 | |
cellranger_atac_version | cellranger-atac version, currently only 1.1.0 | “1.1.0” | “1.1.0” |
docker_registry | Docker registry to use for cellranger_workflow. Options:
|
“cumulusprod” | “cumulusprod” |
zones | Google cloud zones | “us-central1-a us-west1-a” | “us-central1-a us-central1-b us-central1-c us-central1-f us-east1-b us-east1-c us-east1-d us-west1-a us-west1-b us-west1-c” |
atac_num_cpu | Number of cpus for cellranger-atac count | 64 | 64 |
atac_memory | Memory string for cellranger-atac count | “57.6G” | “57.6G” |
mkfastq_disk_space | Optional disk space in GB for cellranger-atac mkfastq | 1500 | 1500 |
atac_disk_space | Disk space in GB needed for cellranger-atac count | 500 | 500 |
preemptible | Number of preemptible tries | 2 | 2 |
Workflow output¶
See the table below for important scATAC-seq outputs.
Name | Type | Description |
---|---|---|
output_fastqs_directory | Array[String] | A list of google bucket urls containing FASTQ files, one url per flowcell. |
output_count_directory | Array[String] | A list of google bucket urls containing cellranger-atac count outputs, one url per sample. |
metrics_summaries | File | A excel spreadsheet containing QCs for each sample. |
output_web_summary | Array[File] | A list of htmls visualizing QCs for each sample (cellranger count output). |
count_matrix | String | gs url for a template count_matrix.csv to run cumulus. |
Aggregate scATAC-Seq Samples¶
To aggregate multiple scATAC-Seq samples, follow the instructions below:
- Import
cellranger_atac_aggr
workflow. Please see Step 1 here, and the name of workflow is “cumulus/cellranger_atac_aggr”. - Set the inputs of workflow. Please see the description of inputs below. Notice that required inputs are shown in bold:
Name | Description | Example | Default |
---|---|---|---|
aggr_id | Aggregate ID. | “aggr_sample” | |
input_counts_directories | A string contains comma-separated URLs to directories of samples to be aggregated. | “gs://fc-e0000000-0000-0000-0000-000000000000/data/sample1,gs://fc-e0000000-0000-0000-0000-000000000000/data/sample2” | |
output_directory | Output directory | “gs://fc-e0000000-0000-0000-0000-000000000000/aggregate_result” | |
genome | The reference genome name used by Cell Ranger, can be either a keyword of pre-built genome, or a Google Bucket URL. See this table for the list of keywords of pre-built genomes. | “GRCh38_atac_v1.2.0” | |
normalize | Sample normalization mode.
Options are: none , depth , or signal . |
“none” | “none” |
secondary | Perform secondary analysis (dimensionality reduction, clustering and visualization). | false | false |
dim_reduce | Chose the algorithm for dimensionality reduction prior to clustering and tsne.
Options are: lsa , plsa , or pca . |
“lsa” | “lsa” |
cellranger_atac_version | Cell Ranger ATAC version to use.
Options: 1.2.0 . |
“1.2.0” | “1.2.0” |
zones | Google cloud zones | “us-central1-a us-west1-a” | “us-central1-b” |
num_cpu | Number of cpus to request for cellranger atac aggr. | 64 | 64 |
memory | Memory size string for cellranger atac aggr. | “57.6G” | “57.6G” |
disk_space | Disk space in GB needed for cellranger atac aggr. | 500 | 500 |
preemptible | Number of preemptible tries. | 2 | 2 |
docker_registry | Docker registry to use for cellranger_workflow. Options:
|
“cumulusprod” | “cumulusprod” |
- Check out the output in
output_directory/aggr_id
folder, whereoutput_directory
andaggr_id
are the inputs you set in Step 2.
Single-cell immune profiling¶
To process single-cell immune profiling (scIR-seq) data, follow the specific instructions below.
Sample sheet¶
Reference column.
Pre-built scIR-seq references are summarized below.
Keyword Description GRCh38_vdj_v3.1.0 Human GRCh38 V(D)J sequences, cellranger reference 3.1.0, annotation built from Ensembl Homo_sapiens.GRCh38.94.chr_patch_hapl_scaff.gtf GRCm38_vdj_v3.1.0 Mouse GRCm38 V(D)J sequences, cellranger reference 3.1.0, annotation built from Ensembl Mus_musculus.GRCm38.94.gtf GRCh38_vdj_v2.0.0 or GRCh38_vdj Human GRCh38 V(D)J sequences, cellranger reference 2.0.0, annotation built from Ensembl Homo_sapiens.GRCh38.87.chr_patch_hapl_scaff.gtf and vdj_GRCh38_alts_ensembl_10x_genes-2.0.0.gtf GRCm38_vdj_v2.2.0 or GRCm38_vdj Mouse GRCm38 V(D)J sequences, cellranger reference 2.2.0, annotation built from Ensembl Mus_musculus.GRCm38.90.chr_patch_hapl_scaff.gtf Index column.
Put 10x single cell V(D)J sample index set names (e.g. SI-GA-A3) here.
Chemistry column.
This column is not used for scIR-seq data. Put fiveprime here as a placeholder if you decide to include the Chemistry column.
DataType column.
Set it to vdj.
FetureBarcodeFile column.
Leave it blank for scIR-seq.
Example:
Sample,Reference,Flowcell,Lane,Index,Chemistry,DataType sample_vdj,GRCh38_vdj_v3.1.0,gs://fc-e0000000-0000-0000-0000-000000000000/VK10WBC9ZZ,1,SI-GA-A1,fiveprime,vdj
Workflow input¶
For scIR-seq data, cellranger_workflow
takes Illumina outputs as input and runs cellranger mkfastq
and cellranger vdj
. Revalant workflow inputs are described below, with required inputs highlighted in bold.
Name | Description | Example | Default |
---|---|---|---|
input_csv_file | Sample Sheet (contains Sample, Reference, Flowcell, Lane, Index as required and Chemistry, DataType, FeatureBarcodeFile as optional) | “gs://fc-e0000000-0000-0000-0000-000000000000/sample_sheet.csv” | |
output_directory | Output directory | “gs://fc-e0000000-0000-0000-0000-000000000000/cellranger_output” | |
run_mkfastq | If you want to run cellranger mkfastq |
true | true |
delete_input_directory | If delete BCL directories after demux. If false, you should delete this folder yourself so as to not incur storage charges | false | false |
force_cells | Force pipeline to use this number of cells, bypassing the cell detection algorithm | 6000 | |
vdj_denovo | Do not align reads to reference V(D)J sequences before de novo assembly | false | false |
cellranger_version | cellranger version, could be 3.1.0, 3.0.2, 2.2.0 | “3.1.0” | “3.1.0” |
docker_registry | Docker registry to use for cellranger_workflow. Options:
|
“cumulusprod” | “cumulusprod” |
cellranger_mkfastq_docker_registry | Docker registry to use for cellranger mkfastq .
Default is the registry to which only Broad users have access.
See bcl2fastq for making your own registry. |
“gcr.io/broad-cumulus” | “gcr.io/broad-cumulus” |
zones | Google cloud zones | “us-central1-a us-west1-a” | “us-central1-a us-central1-b us-central1-c us-central1-f us-east1-b us-east1-c us-east1-d us-west1-a us-west1-b us-west1-c” |
num_cpu | Number of cpus to request for one node for cellranger mkfastq and cellranger vdj | 32 | 32 |
memory | Memory size string for cellranger mkfastq and cellranger vdj | “120G” | “120G” |
mkfastq_disk_space | Optional disk space in GB for mkfastq | 1500 | 1500 |
vdj_disk_space | Disk space in GB needed for cellranger vdj | 500 | 500 |
preemptible | Number of preemptible tries | 2 | 2 |
Workflow output¶
See the table below for important scIR-seq outputs.
Name | Type | Description |
---|---|---|
output_fastqs_directory | Array[String] | A list of google bucket urls containing FASTQ files, one url per flowcell. |
output_vdj_directory | Array[String] | A list of google bucket urls containing vdj results, one url per sample. |
metrics_summaries | File | A excel spreadsheet containing QCs for each sample. |
output_web_summary | Array[File] | A list of htmls visualizing QCs for each sample (cellranger count output). |
count_matrix | String | gs url for a template count_matrix.csv to run cumulus. |
Build Cell Ranger References¶
We provide routines wrapping Cell Ranger tools to build references for sc/snRNA-seq, scATAC-seq and single-cell immune profiling data.
Build references for sc/snRNA-seq¶
We provide a wrapper of cellranger mkref
to build sc/snRNA-seq references. Please follow the instructions below.
1. Import cellranger_create_reference
¶
Import cellranger_create_reference workflow to your workspace.
See the Terra documentation for adding a workflow. The cellranger_workflow workflow is under
Broad Methods Repository
with name “cumulus/cellranger_create_reference”.Moreover, in the workflow page, click the
Export to Workspace...
button, and select the workspace to which you want to export cellranger_create_reference workflow in the drop-down menu.
2. Upload requred data to Google Bucket¶
Required data may include input sample sheet, genome FASTA files and gene annotation GTF files.
3. Input sample sheet¶
If multiple species are specified, a sample sheet in CSV format is required. We describe the sample sheet format below, with required columns highlighted in bold:
Column Description Genome Genome name Fasta Location to the genome assembly in FASTA/FASTA.gz format Genes Location to the gene annotation file in GTF/GTF.gz format Attributes Optional, A list of key:value
pairs separated by;
. If set,cellranger mkgtf
will be called to filter the user-provided GTF file. See 10x filter with mkgtf for more detailsPlease note that the columns in the CSV can be in any order, but that the column names must match the recognized headings.
See below for an example for building Example:
Genome,Fasta,Genes,Attributes GRCh38,gs://fc-e0000000-0000-0000-0000-000000000000/GRCh38.fa.gz,gs://fc-e0000000-0000-0000-0000-000000000000/GRCh38.gtf.gz,gene_biotype:protein_coding;gene_biotype:lincRNA;gene_biotype:antisense mm10,gs://fc-e0000000-0000-0000-0000-000000000000/mm10.fa.gz,gs://fc-e0000000-0000-0000-0000-000000000000/mm10.gtf.gzIf multiple species are specified, the reference will built under Genome names concatenated by ‘_and_’s. In the above example, the reference is stored under ‘GRCh38_and_mm10’.
4. Workflow input¶
Required inputs are highlighted in bold. Note that input_sample_sheet and input_fasta, input_gtf , genome and attributes are mutually exclusive.
Name Description Example Default input_sample_sheet A sample sheet in CSV format allows users to specify more than 1 genomes to build references (e.g. human and mouse). If a sample sheet is provided, input_fasta, input_gtf, and attributes will be ignored. “gs://fc-e0000000-0000-0000-0000-000000000000/input_sample_sheet.csv” input_fasta Input genome reference in either FASTA or FASTA.gz format “gs://fc-e0000000-0000-0000-0000-000000000000/Homo_sapiens.GRCh38.dna.toplevel.fa.gz” input_gtf Input gene annotation file in either GTF or GTF.gz format “gs://fc-e0000000-0000-0000-0000-000000000000/Homo_sapiens.GRCh38.94.chr_patch_hapl_scaff.gtf.gz” genome Genome reference name. New reference will be stored in a folder named genome refdata-cellranger-vdj-GRCh38-alts-ensembl-3.1.0 output_directory Output directory “gs://fc-e0000000-0000-0000-0000-000000000000/cellranger_reference” attributes A list of key:value
pairs separated by;
. If this option is not None,cellranger mkgtf
will be called to filter the user-provided GTF file. See 10x filter with mkgtf for more details“gene_biotype:protein_coding;gene_biotype:lincRNA;gene_biotype:antisense” pre_mrna If we want to build pre-mRNA references, in which we use full length transcripts as exons in the annotation file. We follow 10x build Cell Ranger compatible pre-mRNA Reference Package to build pre-mRNA references true false ref_version reference version string Ensembl v94 cellranger_version cellranger version, could be 3.1.0, 3.0.2, or 2.2.0 “3.1.0” “3.1.0” docker_registry Docker registry to use for cellranger_workflow. Options:
- “cumulusprod” for Docker Hub images;
- “quay.io/cumulus” for backup images on Red Hat registry.
“cumulusprod” “cumulusprod” zones Google cloud zones “us-central1-a us-west1-a” “us-central1-a us-central1-b us-central1-c us-central1-f us-east1-b us-east1-c us-east1-d us-west1-a us-west1-b us-west1-c” num_cpu Number of cpus to request for one node for building indices 1 1 memory Memory size string for cellranger-atac mkref “32G” “32G” disk_space Optional disk space in GB 100 100 preemptible Number of preemptible tries 2 2
5. Workflow output¶
Name Type Description output_reference File Gzipped reference folder with name genome.tar.gz. We will also store a copy of the gzipped tarball under output_directory specified in the input.
Build references for scATAC-seq¶
We provide a wrapper of cellranger-atac mkref
to build scATAC-seq references. Please follow the instructions below.
1. Import cellranger_atac_create_reference
¶
Import cellranger_atac_create_reference workflow to your workspace.
See the Terra documentation for adding a workflow. The cellranger_workflow workflow is under
Broad Methods Repository
with name “cumulus/cellranger_atac_create_reference”.Moreover, in the workflow page, click the
Export to Workspace...
button, and select the workspace to which you want to export cellranger_atac_create_reference workflow in the drop-down menu.
2. Upload required data to Google Bucket¶
Required data include config JSON file, genome FASTA file, gene annotation file (GTF or GFF3 format) and motif input file (JASPAR format).
3. Workflow input¶
Required inputs are highlighted in bold.
Name Description Example Default genome Genome reference name. New reference will be stored in a folder named genome refdata-cellranger-atac-mm10-1.1.0 config_json Configuration file defined in 10x genomics configuration file. Note that links to files in the JSON must be Google bucket URLs “gs://fc-e0000000-0000-0000-0000-000000000000/config.json” output_directory Output directory “gs://fc-e0000000-0000-0000-0000-000000000000/cellranger_atac_reference” cellranger_atac_version cellranger-atac version, could be 1.1.0 “1.1.0” “1.1.0” docker_registry Docker registry to use for cellranger_workflow. Options:
- “cumulusprod” for Docker Hub images;
- “quay.io/cumulus” for backup images on Red Hat registry.
“cumulusprod” “cumulusprod” zones Google cloud zones “us-central1-a us-west1-a” “us-central1-a us-central1-b us-central1-c us-central1-f us-east1-b us-east1-c us-east1-d us-west1-a us-west1-b us-west1-c” memory Memory size string for cellranger-atac mkref “32G” “32G” disk_space Optional disk space in GB 100 100 preemptible Number of preemptible tries 2 2
4. Workflow output¶
Name Type Description output_reference File Gzipped reference folder with name genome.tar.gz. We will also store a copy of the gzipped tarball under output_directory specified in the input.
Build references for single-cell immune profiling data¶
We provide a wrapper of cellranger mkvdjref
to build single-cell immune profiling references. Please follow the instructions below.
1. Import cellranger_vdj_create_reference
¶
Import cellranger_vdj_create_reference workflow to your workspace.
See the Terra documentation for adding a workflow. The cellranger_workflow workflow is under
Broad Methods Repository
with name “cumulus/cellranger_vdj_create_reference”.Moreover, in the workflow page, click the
Export to Workspace...
button, and select the workspace to which you want to export cellranger_vdj_create_reference workflow in the drop-down menu.
2. Upload requred data to Google Bucket¶
Required data include genome FASTA file and gene annotation file (GTF format).
3. Workflow input¶
Required inputs are highlighted in bold.
Name Description Example Default input_fasta Input genome reference in either FASTA or FASTA.gz format “gs://fc-e0000000-0000-0000-0000-000000000000/Homo_sapiens.GRCh38.dna.toplevel.fa.gz” input_gtf Input gene annotation file in either GTF or GTF.gz format “gs://fc-e0000000-0000-0000-0000-000000000000/Homo_sapiens.GRCh38.94.chr_patch_hapl_scaff.gtf.gz” genome Genome reference name. New reference will be stored in a folder named genome refdata-cellranger-vdj-GRCh38-alts-ensembl-3.1.0 output_directory Output directory “gs://fc-e0000000-0000-0000-0000-000000000000/cellranger_vdj_reference” ref_version reference version string Ensembl v94 cellranger_version cellranger version, could be 3.1.0, 3.0.2, or 2.2.0 “3.1.0” “3.1.0” docker_registry Docker registry to use for cellranger_workflow. Options:
- “cumulusprod” for Docker Hub images;
- “quay.io/cumulus” for backup images on Red Hat registry.
“cumulusprod” “cumulusprod” zones Google cloud zones “us-central1-a us-west1-a” “us-central1-a us-central1-b us-central1-c us-central1-f us-east1-b us-east1-c us-east1-d us-west1-a us-west1-b us-west1-c” memory Memory size string for cellranger-atac mkref “32G” “32G” disk_space Optional disk space in GB 100 100 preemptible Number of preemptible tries 2 2
4. Workflow output¶
Name Type Description output_reference File Gzipped reference folder with name genome.tar.gz. We will also store a copy of the gzipped tarball under output_directory specified in the input.